Gene Details:
- Gene ID: TraesCS5D02G004000
- Gene Symbol: Gsp-1
- Gene Name: Softness Protein-1
- Genome: Chinese_Spring1.0
- Species: Triticum aestivum
Functional Descriptions:
- In hexaploid wheat, the tight linkage among these three genes has not been broken, such that the Ha locus haplotype (Pina-D1, Pinb-D1 and Gsp-D1) is associated with kernel texture phenotype.
- Both Pin genes have been deleted from chromosomes 5A and 5B during the evolution of durum wheat (the contributor of A and B genomes of common wheat). In contrast, all three Gsp-1 genes (from the A, B and D genomes) are conserved in common wheat.
- Among members of the Triticeae, most notably wheat, much of the variation in texture is controlled by a single locus comprised of the Puroindoline a, Puroindoline b and Grain Softness Protein-1 (Gsp-1) genes.
Function-related keywords:
Literature:
- Molecular genetics of puroindolines and related genes: allelic diversity in wheat and other grasses. DOI: 10.1007/s11103-007-9263-7 ; PMID: 18049798
Related News:
Gene Resources:
Sequences:
cDNA Sequence
- >TraesCS5D02G004000.1
ATGAAGACCTTCTTCCTCCTAGCTTTCCTTGCTCTGGTAGTGAGCACTGCTATTGCGCAATATGCAGAAGTTCCCAGCCCAGCTGCGCAAGCTCCCACCGCGGATGGTTTTGGGGAATGGGTTGCGATAGCGCCTAGTGCGAGTGGTTCTGAGAATTGCGAGGAAGAGCAGCCAAAGGTAGACTCTTGTAGCGATTATGTTATGGATCGGTGTGTGATGAAGGATATGCCGCTCTCTTGGTTCTTTCCTCGGACTTGGGGGAAGAGAAGTTGTGAGGAGGTCCGAAACCAGTGTTGTAAGCAATTGAGGCAAACGACGTCGCGTTGCCGTTGCAAGGCTATATGGACATCAATCCAAGGCGATCTAAGTGGCTTCAAGGGCCTTCAACAAGGTCTTAAAGCCAGAACGGTGCAGACGGCCAAGAGCCTTCCCACCCAGTGCAACATTGATCCGAAATTCTGCAACATCCCCATCACTAGCGGATATTACTTGTGA
CDS Sequence
- >TraesCS5D02G004000.1
ATGAAGACCTTCTTCCTCCTAGCTTTCCTTGCTCTGGTAGTGAGCACTGCTATTGCGCAATATGCAGAAGTTCCCAGCCCAGCTGCGCAAGCTCCCACCGCGGATGGTTTTGGGGAATGGGTTGCGATAGCGCCTAGTGCGAGTGGTTCTGAGAATTGCGAGGAAGAGCAGCCAAAGGTAGACTCTTGTAGCGATTATGTTATGGATCGGTGTGTGATGAAGGATATGCCGCTCTCTTGGTTCTTTCCTCGGACTTGGGGGAAGAGAAGTTGTGAGGAGGTCCGAAACCAGTGTTGTAAGCAATTGAGGCAAACGACGTCGCGTTGCCGTTGCAAGGCTATATGGACATCAATCCAAGGCGATCTAAGTGGCTTCAAGGGCCTTCAACAAGGTCTTAAAGCCAGAACGGTGCAGACGGCCAAGAGCCTTCCCACCCAGTGCAACATTGATCCGAAATTCTGCAACATCCCCATCACTAGCGGATATTACTTGTGA
Protein Sequence
- >TraesCS5D02G004000.1.cds1
MKTFFLLAFLALVVSTAIAQYAEVPSPAAQAPTADGFGEWVAIAPSASGSENCEEEQPKVDSCSDYVMDRCVMKDMPLSWFFPRTWGKRSCEEVRNQCCKQLRQTTSRCRCKAIWTSIQGDLSGFKGLQQGLKARTVQTAKSLPTQCNIDPKFCNIPITSGYYL