Information report for TRIUR3_35266-P1
Gene Details
|
|
Functional Annotation
- Refseq: XP_020178161.1 — nuclear transcription factor Y subunit B-8-like
- TrEMBL: M7ZF84 — M7ZF84_TRIUA; Nuclear transcription factor Y subunit B-6
- STRING: TRIUR3_35266-P1 — (Triticum urartu)
- GO:0006355 — Biological Process — regulation of transcription, DNA-templated
- GO:0005634 — Cellular Component — nucleus
- GO:0043565 — Molecular Function — sequence-specific DNA binding
- GO:0046982 — Molecular Function — protein heterodimerization activity
Family Introduction
- NF-Y transcription factors are likely found in all eukaryotes and have roles in the regulation of diverse genes (McNabb et al., 1995; Edwards et al., 1998; Maity and de Crombrugghe, 1998; Mantovani, 1999). In mammals, where their biochemistry is well described, the NF-Y transcription factor complex is composed of three unique subunits: NF-YA, NF-YB, and NF-YC. Assembly of the NF-Y heterotrimer in mammals follows a strict, stepwise pattern (Sinha et al., 1995, 1996). Initially, a heterodimer is formed in the cytoplasm between the subunits NF-YB and NF-YC. This dimer then translocates to the nucleus, where the third subunit, NF-YA, is recruited to generate the mature, heterotrimeric NF-Y transcription factor (Frontini et al., 2004; Kahle et al., 2005). Mature NF-Y binds promoters with the core pentamer nucleotide sequence CCAAT, and this can result in either positive or negative transcriptional regulation(Peng and Jahroudi, 2002, 2003; Ceribelli et al., 2008).
- As with NF-YA, NF-YB and NF-YC families have well-described subunit interaction and DNA-binding domains ( Kim et al., 1996; Sinha et al., 1996; McNabb et al., 1997; Romier et al., 2003). The conserved regions of NF-YB and NF-YC have structural and amino acid homology to histone fold motifs. Specifically, NF-YB is related to the histone fold motifs of H2B histones, while NF-YC subunits are related to H2A histones (Mantovani, 1999).
Literature and News
Gene Resources
Sequences
CDS Sequence:
- >TRIUR3_35266-P1|Triticum_urartu|NF-YB|TRIUR3_35266-P1
ATGGAGAACGACGGCGTCCCCAACGGACCAGCGGCGCCGGCGCCTACCCAGGCGACGCCGGTGGTGCGGGAGCAGGACCGGCTGATGCCGATCGCAAACGTGATCCGCATCATGCGCCGCGCGCTCCCTGCCCATGCCAAGATCTCCGACGAAGCCAAGGAGGCGATCCAGGAATGCGTGTCGGAGTTCATCAGCTTCGTCACCGGCGAGGCCAACGAACGGTGCCGCATGCAGCGCCGCAAGGCCGTCAACGCCGAAGACATCGTGTGGGCCCTAAACCGCCTCGGCTTCGACGACTACGTCGTGCCCCTCAGCGTCTTCCTGAAGCGCATGCGCGACCCCGATGCGGGGACAGTCGCGCTTGAAGTGGCCTCGCTGACCACAATTGTAGCAGCGCCCGCGCCTATTCCCGCCGTTGCTCGACGCCACGCTCTTGCCGTCGTCGTCGTCCCGAGCACCGCCGTGTCGACGCTCCCGTGCTGCCCACTGCGCCGCCGTCATGAGCAGCTACTCACCCCCGCGCTCGCCGCCGTCTTGTCCACGGCGCCGAACCCTCTCATTGAACGCACGCAGCCGCCCGAGCGCTTCGTCGAACGCCATCGTCGTCACGTCGTGGAACTGCTCGATGCCGGCGACGACGGGGAAGAGGCGATCCGGCACCGTATCCAACAACTTCTTGACAAGTGCTGCGTCGCCAGCGTCTCCCCGAGGTTGGCATACCTCGCCGCCATCGACGCGAGCCTCCCGCCGTACACGTCGAGCTCCTCGCCGTCCGCCATCTTCATCCGGTCGAATTCGCCGCGCAGCGTCTCCAGCCTCGCCGCGCGGACCCGATCAGCGCCGACGAATCTCACCTTCACGGAGTCCCATACCTCCCTGACGGTGAGCTTTGTCGACACCTGCAGCAGCACATCCTCCGGCAACGCCCCGAGGAGCAACGCGCGCGCCATCTTGTCCTTCTTGGCGTTCACCGTCGCGTCGCCCAGCGTCACCGCCTCCCATACGGTTCAGATGCAGCAGGGCATCTATGGGCCCCGGGCTCCAGTGCACGGGTACGCCGTCGGAATGGCACCGGTGCGGGCCAACGTCGGCGGGCAGTACCAGGTGTTCGTCGGAGAGCGTGTCATGGGCCAGCAATACTACGGGTACGGGGAAGGAGCGTACGGCGCAGGTAGCAGCAACGGAGGAGCCGGCATTGGCGACCAGGAGAGCTCGTCCAACGGCGTGCCGGCGCCGGGGGAGGGCAAGGGGGAGCCAGAGCCAGAGCCAACAGCAGAAGAACCGCAGGACAAGCCCGTCCAATCTGGCTAG
Protein Sequence:
- >TRIUR3_35266-P1|Triticum_urartu|NF-YB|TRIUR3_35266-P1
MENDGVPNGPAAPAPTQATPVVREQDRLMPIANVIRIMRRALPAHAKISDEAKEAIQECVSEFISFVTGEANERCRMQRRKAVNAEDIVWALNRLGFDDYVVPLSVFLKRMRDPDAGTVALEVASLTTIVAAPAPIPAVARRHALAVVVVPSTAVSTLPCCPLRRRHEQLLTPALAAVLSTAPNPLIERTQPPERFVERHRRHVVELLDAGDDGEEAIRHRIQQLLDKCCVASVSPRLAYLAAIDASLPPYTSSSSPSAIFIRSNSPRSVSSLAARTRSAPTNLTFTESHTSLTVSFVDTCSSTSSGNAPRSNARAILSFLAFTVASPSVTASHTVQMQQGIYGPRAPVHGYAVGMAPVRANVGGQYQVFVGERVMGQQYYGYGEGAYGAGSSNGGAGIGDQESSSNGVPAPGEGKGEPEPEPTAEEPQDKPVQSG