Information report for DCAR_002074
Gene Details
|
|
Functional Annotation
- Refseq: XP_017258244.1 — PREDICTED: nuclear transcription factor Y subunit A-1
- Refseq: XP_017258253.1 — PREDICTED: nuclear transcription factor Y subunit A-1
- Swissprot: Q9LXV5 — NFYA1_ARATH; Nuclear transcription factor Y subunit A-1
- TrEMBL: A0A166GW66 — A0A166GW66_DAUCS; Uncharacterized protein
- STRING: PGSC0003DMT400027785 — (Solanum tuberosum)
- GO:0006355 — Biological Process — regulation of transcription, DNA-templated
- GO:0010262 — Biological Process — somatic embryogenesis
- GO:0048510 — Biological Process — regulation of timing of transition from vegetative to reproductive phase
- GO:0055046 — Biological Process — microgametogenesis
- GO:0016602 — Cellular Component — CCAAT-binding factor complex
- GO:0003677 — Molecular Function — DNA binding
- GO:0003700 — Molecular Function — transcription factor activity, sequence-specific DNA binding
Family Introduction
- NF-Y transcription factors are likely found in all eukaryotes and have roles in the regulation of diverse genes (McNabb et al., 1995; Edwards et al., 1998; Maity and de Crombrugghe, 1998; Mantovani, 1999). In mammals, where their biochemistry is well described, the NF-Y transcription factor complex is composed of three unique subunits: NF-YA, NF-YB, and NF-YC. Assembly of the NF-Y heterotrimer in mammals follows a strict, stepwise pattern (Sinha et al., 1995, 1996). Initially, a heterodimer is formed in the cytoplasm between the subunits NF-YB and NF-YC. This dimer then translocates to the nucleus, where the third subunit, NF-YA, is recruited to generate the mature, heterotrimeric NF-Y transcription factor (Frontini et al., 2004; Kahle et al., 2005). Mature NF-Y binds promoters with the core pentamer nucleotide sequence CCAAT, and this can result in either positive or negative transcriptional regulation(Peng and Jahroudi, 2002, 2003; Ceribelli et al., 2008).
- NF-YA proteins are characterized by the presence of Gln(Q)- and Ser/Thr(S/T)-rich NH2 termini, a subunit interaction domain (NF-YB/NF-YC interaction), and a DNA-binding domain (Olesen and Guarente, 1990; Maity and de Crombrugghe, 1992; Xing et al., 1993, 1994). The protein interaction and DNA binding domains are well conserved between plant and other eukaryote lineages.
Literature and News
Gene Resources
Homologs
- Capsicum annuum: CA06g10300
- Juglans regia: Jr14_19640, Jr14_19620
- Petunia inflata: Peinf101Scf13415g00005.1, Peinf101Scf08723g00006.1, Peinf101Scf00755g00010.1
- Sesamum indicum: XP_011090025.1, XP_011090024.1, XP_011090023.1, XP_011080352.1, XP_011080351.1, XP_011080350.1, XP_011080349.1, XP_011080348.1, XP_011080347.1, XP_011080346.1, XP_011080345.1, SIN_1003278, XP_011080343.1
- Solanum lycopersicum: Solyc01g008490.2.1
- Solanum tuberosum: PGSC0003DMP400018923
Sequences
CDS Sequence:
- >DCAR_002074|Daucus_carota|NF-YA|DCAR_002074
ATGCACTCTGCTTCGAAGTCGAGAAAGCAGGTGGAAGCTGATCCCTACAACATTCCGCAATCCACTTTGTGTCCTGAACCATGGTGGCATAACAGTGGATATAATCCTCTTCCCCCAACTATGATGCAAAGTAATGTATCTGAGACATCTTCAGTGGAACAATCAGCTGATGGCAAGTCAAAGTCTGATGGCGGTCAGAATGAAGATGATGAAAACACTACCAAGGATTCACAAACGAATGCACCTATGCATTCAGGGCTGGATGGAAATTTCGGACAAGAGCATCAGAGTCAGCATGTAACATCAAGTACCTCTCTTAAGAATGATGCAAGTCTCACACAACCTCCGCAGCTTGAACTTGTTGGTCACTCCATTGTTCATCCTCATCTAGTTGACATGCATCAAACTCGAATGCCTTTGCACCTTGATATGGCACAAGAGCCTGTTTATGTGAATGCCAAGCAGTACCATGGAATATTACGGCGCAGACAATCACGCGCCAAAGCAGAGCTTGAAAAGAAGCTGATAAAAGATCGAAAGCCCTATCTTCATGAATCTCGGCACCAGCATGCTATTAGAAGGGCAAGGGCTTCAGGTGGTCGTTTTGCCAAGAAGTCTGATGTTGACAATTCAAAGCAGTCGAATGAAGCTAAAGGCAATGGGAAAAATTCTGCCCCAGCTGCTTCAGCTCAATCTTTCAGCTCATCAGGGTCCGAGCCATTGCCGTCAGACTCAAATATGAACTATTATCAGGAGGCAAGAGGACAAACTAATGCACAGACATATGTAAATGATGGCGGGATGTATAGAAACCAAGACGGGGCCACCTCTTTAGTCCAGCAGTGGGGAAACATTAGATCTGATCAGGCTCAGCAGCGGGCTACTGCTATGCACTGA
Protein Sequence:
- >DCAR_002074|Daucus_carota|NF-YA|DCAR_002074
MHSASKSRKQVEADPYNIPQSTLCPEPWWHNSGYNPLPPTMMQSNVSETSSVEQSADGKSKSDGGQNEDDENTTKDSQTNAPMHSGLDGNFGQEHQSQHVTSSTSLKNDASLTQPPQLELVGHSIVHPHLVDMHQTRMPLHLDMAQEPVYVNAKQYHGILRRRQSRAKAELEKKLIKDRKPYLHESRHQHAIRRARASGGRFAKKSDVDNSKQSNEAKGNGKNSAPAASAQSFSSSGSEPLPSDSNMNYYQEARGQTNAQTYVNDGGMYRNQDGATSLVQQWGNIRSDQAQQRATAMH*