Information report for XP_010105221.1
Gene Details
|
|
Functional Annotation
- Refseq: XP_010105221.1 — myb-related protein 306 isoform X1
- Swissprot: B3VTV7 — MYB60_VITVI; Transcription factor MYB60
- TrEMBL: W9RYX6 — W9RYX6_9ROSA; Myb-related protein 306
- STRING: XP_010105221.1 — (Morus notabilis)
- GO:0009414 — Biological Process — response to water deprivation
- GO:0009416 — Biological Process — response to light stimulus
- GO:0009737 — Biological Process — response to abscisic acid
- GO:0009751 — Biological Process — response to salicylic acid
- GO:0009753 — Biological Process — response to jasmonic acid
- GO:0010118 — Biological Process — stomatal movement
- GO:0003677 — Molecular Function — DNA binding
Family Introduction
- MYB factors represent a family of proteins that include the conserved MYB DNA-binding domain.The first MYB gene identified was the ‘oncogene’ v-Myb derived from the avian myeloblastosis virus . Evidence obtained from sequence comparisons indicates that v-Myb may have originated from a vertebrate gene, which mutated once it became part of the virus. Many vertebrates contain three genes related to v-Myb c-Myb, A-Myb and B-Myb and other similar genes have been identified in insects, plants, fungi and slime moulds. The encoded proteins are crucial to the control of proliferation and differentiation in a number of cell types, and share the conserved MYB DNA-binding domain. This domain generally comprises up to three imperfect repeats, each forming a helix-turn-helix structure of about 53 amino acids. Three regularly spaced tryptophan residues, which form a tryptophan cluster in the three-dimensional helix-turn-helix structure, are characteristic of a MYB repeat. The three repeats in c-Myb are referred to as R1, R2 and R3; and repeats from other MYB proteins are categorised according to their similarity to either R1, R2 or R3.
- In contrast to animals, plants contain a MYB-protein subfamily that is characterised by the R2R3-type MYB domain. MYB proteins can be classified into three subfamilies depending on the number of adjacent repeats in the MYB domain (one, two or three). We refer to MYB-like proteins with one repeat as ‘MYB1R factors’, with two as ‘R2R3-type MYB’ factors, and with three repeats as ‘MYB3R’ factors.
Literature and News
Gene Resources
Homologs
- Cajanus cajan: C.cajan_18047
- Citrus sinensis: orange1.1g018559m
- Glycine max: Glyma.19G119300.1.p, Glyma.03G006600.1.p
- Gossypium arboreum: Cotton_A_18881_BGI-A2_v1.0
- Gossypium hirsutum: Gh_D11G2341, Gh_A11G2037
- Juglans regia: WALNUT_00011695-RA
- Lotus japonicus: Lj1g3v4012910.1
- Malus domestica: MDP0000163673, MDP0000168550
- Manihot esculenta: Manes.09G135700.1.p
- Populus trichocarpa: Potri.019G045900.1, Potri.013G067500.1
- Prunus mume: XP_008240570.1
- Prunus persica: Prupe.7G018400.1.p
- Pyrus bretschneideri: Pbr016839.1, Pbr002014.1
- Ziziphus jujuba: XP_015899725.1
Sequences
CDS Sequence:
- >XP_010105221.1|Morus_notabilis|MYB|XP_010105221.1
ATGGGAAGGCCCCCTTGCTGTGACAAAGTTGGCATCAAGAAAGGTCCATGGACCCCTGAAGAAGACATCATCCTTGTTTCTTACATCCAAGAACATGGTCCTGGAAATTGGAGATCAGTTCCCACCAACACTGGGTTGTTGAGATGCAGCAAGAGTTGCAGGCTCAGATGGACAAACTACCTGAGGCCAGGAATCAAGAGAGGAAACTTCACACCTCACGAAGAAGGAATGATAATTCATTTGCAAGCTTTATTGGGTAACAAATGGGCAGCCATAGCTTCCTACCTCCCACAAAGAACAGATAATGATATAAAGAATTATTGGAACACACATCTGAAGAAGAAGCTCAAGAAATTCCAATCAGTTTTCGATCCTCACAACAATAATATCCCATCTGACTCAACCACTGGCCAGTTGGTATCAAACAGGAGTTCTGGTACTACTTTCAGTGATAGAAGAAGCTTAGCTGATTATGTCACCAGCCATGGCTCTTCTGATAATCATCTCAGCCTACAGAATTCCTCCTCTTCTTCTCCTCCATCTACATATGCCTCCAGCACTGAAAACATCTCGCGCCTCTTAGAAGGTTGGATGAGATCTTCTCCAAAACCTAATAAAAGTATTAGTACTACTAGCATTAGTGACCACAATATCACAATAAAAGTGTTTGAGAATGATGGCAACGGCACTCTTCCAAGCGGCGGTGGCAGCGGGATGAAAGTTGAGGAGGCAGCAGAGGGGGGCGATCTCGTCTCTCACGACGAGTTTGAGTCGATCATGTCGTTCGATCCGAACACGAACAATGTTGTTTCGTCGTGCGACAGGTCAACTTGCGAATCTACTTCTTATAAGGTTTCTGCTGTGGATAATGAAGACATGATCAAGGTTCATGTTGTGATGGAGAAGAATAGTATTAAGCAAAGATCTGAGAGCGGCGCTAGTAATCCTCCATTGTCGTTTCTTGAGAAATGGCTCTTGGATGAGAGTACTATTGGTGCTACGGCTGGTCAAGTAGAGGAGATGATGGAATTGTCTCCAATGTTTTAA
Protein Sequence:
- >XP_010105221.1|Morus_notabilis|MYB|XP_010105221.1
MGRPPCCDKVGIKKGPWTPEEDIILVSYIQEHGPGNWRSVPTNTGLLRCSKSCRLRWTNYLRPGIKRGNFTPHEEGMIIHLQALLGNKWAAIASYLPQRTDNDIKNYWNTHLKKKLKKFQSVFDPHNNNIPSDSTTGQLVSNRSSGTTFSDRRSLADYVTSHGSSDNHLSLQNSSSSSPPSTYASSTENISRLLEGWMRSSPKPNKSISTTSISDHNITIKVFENDGNGTLPSGGGSGMKVEEAAEGGDLVSHDEFESIMSFDPNTNNVVSSCDRSTCESTSYKVSAVDNEDMIKVHVVMEKNSIKQRSESGASNPPLSFLEKWLLDESTIGATAGQVEEMMELSPMF