Information report for XP_010090332.1
Gene Details
|
|
Functional Annotation
- Refseq: XP_010090332.1 — myb-related protein 308
- Swissprot: P81393 — MYB08_ANTMA; Myb-related protein 308
- TrEMBL: W9QT08 — W9QT08_9ROSA; Myb-related protein 308
- STRING: XP_010090332.1 — (Morus notabilis)
- GO:0009751 — Biological Process — response to salicylic acid
- GO:0009753 — Biological Process — response to jasmonic acid
- GO:0010224 — Biological Process — response to UV-B
- GO:0045892 — Biological Process — negative regulation of transcription, DNA-templated
- GO:0090379 — Biological Process — secondary cell wall biogenesis involved in seed trichome differentiation
- GO:1903086 — Biological Process — negative regulation of sinapate ester biosynthetic process
- GO:0003677 — Molecular Function — DNA binding
Family Introduction
- MYB factors represent a family of proteins that include the conserved MYB DNA-binding domain.The first MYB gene identified was the ‘oncogene’ v-Myb derived from the avian myeloblastosis virus . Evidence obtained from sequence comparisons indicates that v-Myb may have originated from a vertebrate gene, which mutated once it became part of the virus. Many vertebrates contain three genes related to v-Myb c-Myb, A-Myb and B-Myb and other similar genes have been identified in insects, plants, fungi and slime moulds. The encoded proteins are crucial to the control of proliferation and differentiation in a number of cell types, and share the conserved MYB DNA-binding domain. This domain generally comprises up to three imperfect repeats, each forming a helix-turn-helix structure of about 53 amino acids. Three regularly spaced tryptophan residues, which form a tryptophan cluster in the three-dimensional helix-turn-helix structure, are characteristic of a MYB repeat. The three repeats in c-Myb are referred to as R1, R2 and R3; and repeats from other MYB proteins are categorised according to their similarity to either R1, R2 or R3.
- In contrast to animals, plants contain a MYB-protein subfamily that is characterised by the R2R3-type MYB domain. MYB proteins can be classified into three subfamilies depending on the number of adjacent repeats in the MYB domain (one, two or three). We refer to MYB-like proteins with one repeat as ‘MYB1R factors’, with two as ‘R2R3-type MYB’ factors, and with three repeats as ‘MYB3R’ factors.
Literature and News
Gene Resources
Homologs
- Actinidia chinensis: Achn020361
- Citrullus lanatus: Cla020285
- Cucumis melo: MELO3C020812P1
- Cucumis sativus: Cucsa.234310.1
- Fragaria vesca: mrna07646.1-v1.0-hybrid
- Gossypium arboreum: Cotton_A_31284_BGI-A2_v1.0
- Gossypium hirsutum: Gh_D01G1631, Gh_A01G1387, Gh_D12G0316
- Malus domestica: MDP0000950559, MdMYB308L, MDP0000249611
- Manihot esculenta: Manes.11G094800.1.p, Manes.04G074900.1.p
- Populus trichocarpa: Potri.004G174400.1
- Prunus mume: XP_008236005.1
- Prunus persica: Prupe.8G164300.1.p
- Pyrus bretschneideri: Pbr020733.1, Pbr020726.1
- Ricinus communis: 29602.m000218
- Ziziphus jujuba: XP_015866915.1
Sequences
CDS Sequence:
- >XP_010090332.1|Morus_notabilis|MYB|XP_010090332.1
ATGGGACGGTCTCCTTGCTGTGAGAAAGCTCACACAAACAAAGGAGCATGGACCAAAGAAGAAGATGATCGGCTCATTGCTTATATCAGAGCTCACGGCGAGGGATGTTGGCGCTCACTTCCCAAAGCCGCCGGTCTCCTCCGGTGCGGCAAGAGTTGCCGGCTGCGGTGGATTAACTACCTCAGACCTGACCTTAAACGAGGCAACTTCACAGAAGAAGAAGACGAGCTAATCATTAAGCTCCATAGCCTTCTTGGAAACAAATGGTCTTTGATAGCTGGCAGACTACCGGGAAGAACAGACAATGAGATAAAGAACTATTGGAACACCCACATAAGGAGGAAGCTTTTGAACAGAGGTATTGACCCGGCAACACACAAGCTGCTCAACGAGACGGCTCAGGACAACACAACAACCACCCCAACCACCACAACAATATCGTTTGCGGCCTCTACTACTCCTACTACTATTGTTAAAGAAGAAGAGAAAAAGATCAACGGTGGATTTGTGAGCAAAGACGTGAAAAACCCGGTTCAAGAACAGTGCCCGGACTTGAACCTTGAGCTTAGAATTAGCCCTCCTTATCAGCCACAACAGCCGGAGCAATTGAAGAGTGGAGGAGGGGGCCTATGCTTTTCTTGCCGTTTGGGGTTGCAGACCAGCAAAGAATGCCGCTGCGGAATAATTACCAGCATTGATAGCACCAGCGCAAGCACTAGTGTTGGTTATGATTTCTTGGGGTTGAAAACTGGTGTTTTGGATTACAGAAGCTTGGAGATGAAATAA
Protein Sequence:
- >XP_010090332.1|Morus_notabilis|MYB|XP_010090332.1
MGRSPCCEKAHTNKGAWTKEEDDRLIAYIRAHGEGCWRSLPKAAGLLRCGKSCRLRWINYLRPDLKRGNFTEEEDELIIKLHSLLGNKWSLIAGRLPGRTDNEIKNYWNTHIRRKLLNRGIDPATHKLLNETAQDNTTTTPTTTTISFAASTTPTTIVKEEEKKINGGFVSKDVKNPVQEQCPDLNLELRISPPYQPQQPEQLKSGGGGLCFSCRLGLQTSKECRCGIITSIDSTSASTSVGYDFLGLKTGVLDYRSLEMK