Information report for TRIUR3_31689-P1
Gene Details
|
|
Functional Annotation
- Refseq: XP_020199233.1 — myb-related protein P-like isoform X1
- Swissprot: P27898 — MYBP_MAIZE; Myb-related protein P
- TrEMBL: M8A861 — M8A861_TRIUA; Myb-related protein P
- STRING: TRIUR3_31689-P1 — (Triticum urartu)
- GO:0009651 — Biological Process — response to salt stress
- GO:0009723 — Biological Process — response to ethylene
- GO:0009733 — Biological Process — response to auxin
- GO:0009813 — Biological Process — flavonoid biosynthetic process
- GO:0045893 — Biological Process — positive regulation of transcription, DNA-templated
- GO:0005634 — Cellular Component — nucleus
- GO:0003677 — Molecular Function — DNA binding
Family Introduction
- MYB factors represent a family of proteins that include the conserved MYB DNA-binding domain.The first MYB gene identified was the ‘oncogene’ v-Myb derived from the avian myeloblastosis virus . Evidence obtained from sequence comparisons indicates that v-Myb may have originated from a vertebrate gene, which mutated once it became part of the virus. Many vertebrates contain three genes related to v-Myb c-Myb, A-Myb and B-Myb and other similar genes have been identified in insects, plants, fungi and slime moulds. The encoded proteins are crucial to the control of proliferation and differentiation in a number of cell types, and share the conserved MYB DNA-binding domain. This domain generally comprises up to three imperfect repeats, each forming a helix-turn-helix structure of about 53 amino acids. Three regularly spaced tryptophan residues, which form a tryptophan cluster in the three-dimensional helix-turn-helix structure, are characteristic of a MYB repeat. The three repeats in c-Myb are referred to as R1, R2 and R3; and repeats from other MYB proteins are categorised according to their similarity to either R1, R2 or R3.
- In contrast to animals, plants contain a MYB-protein subfamily that is characterised by the R2R3-type MYB domain. MYB proteins can be classified into three subfamilies depending on the number of adjacent repeats in the MYB domain (one, two or three). We refer to MYB-like proteins with one repeat as ‘MYB1R factors’, with two as ‘R2R3-type MYB’ factors, and with three repeats as ‘MYB3R’ factors.
Literature and News
Gene Resources
Homologs
- Brachypodium distachyon: Bradi1g64687.1.p
- Hordeum vulgare: MLOC_57220.1
- Oryza sativa: OsP1
- Panicum virgatum: Pavir.9KG556400.1.p, Pavir.9KG467400.1.p
- Setaria italica: Seita.9G432200.1.p
- Setaria viridis: Sevir.9G436200.1.p
- Triticum aestivum: Traes_4AS_3883DC244.1, Traes_4DL_967152326.1, Rg-B1, Traes_1DS_711044AD5.1
Sequences
CDS Sequence:
- >TRIUR3_31689-P1|Triticum_urartu|MYB|TRIUR3_31689-P1
ATGGGGAGGGCGCCGTGCTGCGAGAAGGTGGGGCTGAAGCGGGGGAGGTGGACGGCGGAGGAGGACGACATACTCGCAAACTACATTGCCAAGCACGGCGAGGGCTCATGGAGGTCTCTTCCCAAGAATGCAGGGCTACTGAGGTGTGGCAAGAGCTGCAGGCTGCGGTGGATCAACTACCTCAGAGACGGGGTGAGGAGAGGCAACATCTCCAAGGAGGAGGACGACCTCATCGTCAAACTTCATGCCACCCTTGGCAACAGATGGTCCCTGATCGCCAGCCACCTACCAGGGCGAACAGACAACGAGATAAAGAATTACTGGAACTCGCATCTCAGCCGGCAGATCCACACCTTCCGGAGGATCTACACCGCCGTCAGCGACACCGCCATAACCGTCGACGTCAACAAGCTTTCCGCCGCCGGCAAGCGGCGCGGCGGCCGCACCCCTGGCCAGTCGCCAAGGAGCAGCACAAAGAAGAAGCCGGTGCCGGAGCCCATCACCAAGGCGAAGGACGAATCTAGCCCGGCCGGCGCTGCGTCATCAGTGTCAAGCTCACCTCACAGCGACGAGGCTAGAAGCGCGGTGGTCGACCCGGACCAGAATCAGCCCAACAACAGCATCAGTGTCAGCCACACTTCTGATGGGCCCTGCAGCGAGGATGGGACGTGGCCCATGGTCATGGACCCTGTTGATCAGACTGGTGTCCTCGAGGCGAACGGCACTGTGGATCAGCAGATGGGGCTCTGGGAAGTGAACAGCTCAATGAATCAGATTGGGATCATGGAGGACGAGAGCGAGATGCAGGCACTCCTGTCCAGCAGCGTTACAGCAGAGAATGGGCTTGTTGGCATCGATCCTGGAGGCCTGTCACAGGTGGACGATCTCTTGGACATGGACTGGGAGGGGTTTGCATCCCATCTATGGGACCAGCCAGCCCAGAATGGCCTTCTACAGCCCGCTGAGCCGCAGGCGGCGAAGGGCTCCGAGTCGGACGAGCTGGAGTCGTTCGTCAGTTGGCTCCTCTCCGACGCGTGCTGA
Protein Sequence:
- >TRIUR3_31689-P1|Triticum_urartu|MYB|TRIUR3_31689-P1
MGRAPCCEKVGLKRGRWTAEEDDILANYIAKHGEGSWRSLPKNAGLLRCGKSCRLRWINYLRDGVRRGNISKEEDDLIVKLHATLGNRWSLIASHLPGRTDNEIKNYWNSHLSRQIHTFRRIYTAVSDTAITVDVNKLSAAGKRRGGRTPGQSPRSSTKKKPVPEPITKAKDESSPAGAASSVSSSPHSDEARSAVVDPDQNQPNNSISVSHTSDGPCSEDGTWPMVMDPVDQTGVLEANGTVDQQMGLWEVNSSMNQIGIMEDESEMQALLSSSVTAENGLVGIDPGGLSQVDDLLDMDWEGFASHLWDQPAQNGLLQPAEPQAAKGSESDELESFVSWLLSDAC