Information report for Tp7g19560
Gene Details
Functional Annotation
- Refseq: XP_022550348.1 — transcription factor MYB102-like
- Swissprot: Q9LDR8 — MY102_ARATH; Transcription factor MYB102
- TrEMBL: A0A078JE85 — A0A078JE85_BRANA; BnaC01g41180D protein
- TrEMBL: A0A3N6SZ65 — A0A3N6SZ65_BRACR; Uncharacterized protein
- TrEMBL: A0A3P6FQ89 — A0A3P6FQ89_BRAOL; Uncharacterized protein
- STRING: Bo7g107420.1 — (Brassica oleracea)
- GO:0009611 — Biological Process — response to wounding
- GO:0009651 — Biological Process — response to salt stress
- GO:0009737 — Biological Process — response to abscisic acid
- GO:0003677 — Molecular Function — DNA binding
Family Introduction
- MYB factors represent a family of proteins that include the conserved MYB DNA-binding domain.The first MYB gene identified was the ‘oncogene’ v-Myb derived from the avian myeloblastosis virus . Evidence obtained from sequence comparisons indicates that v-Myb may have originated from a vertebrate gene, which mutated once it became part of the virus. Many vertebrates contain three genes related to v-Myb c-Myb, A-Myb and B-Myb and other similar genes have been identified in insects, plants, fungi and slime moulds. The encoded proteins are crucial to the control of proliferation and differentiation in a number of cell types, and share the conserved MYB DNA-binding domain. This domain generally comprises up to three imperfect repeats, each forming a helix-turn-helix structure of about 53 amino acids. Three regularly spaced tryptophan residues, which form a tryptophan cluster in the three-dimensional helix-turn-helix structure, are characteristic of a MYB repeat. The three repeats in c-Myb are referred to as R1, R2 and R3; and repeats from other MYB proteins are categorised according to their similarity to either R1, R2 or R3.
- In contrast to animals, plants contain a MYB-protein subfamily that is characterised by the R2R3-type MYB domain. MYB proteins can be classified into three subfamilies depending on the number of adjacent repeats in the MYB domain (one, two or three). We refer to MYB-like proteins with one repeat as ‘MYB1R factors’, with two as ‘R2R3-type MYB’ factors, and with three repeats as ‘MYB3R’ factors.
Literature and News
Gene Resources
Homologs
- Arabidopsis thaliana: AT4G21440.1
- Brassica napus: GSBRNA2T00039325001, GSBRNA2T00156923001, GSBRNA2T00131594001, GSBRNA2T00086720001, GSBRNA2T00106747001, GSBRNA2T00126832001
- Brassica oleracea: XP_013596496.1, XP_013583582.1, XP_013626994.1
- Brassica rapa: XP_009137191.1, XP_009134770.1, XP_009108500.1
- Raphanus raphanistrum: RrC22_p1, RrC540_p4
Sequences
CDS Sequence:
- >Tp7g19560|Thellungiella_parvula|MYB|Tp7g19560
ATGGGAAGATCACCTTGTTGCGAGAAGAACGGACTCAAGAAAGGGCCATGGACGTCTGAGGAAGACCAGAAGCTCGTTGAGTATATCCAGAAACATGGATATGGTAACTGGAGAACACTTCCCAAAAATGCTGGTTTACAGAGATGTGGCAAGAGTTGCCGATTAAGGTGGACTAATTATCTCCGACCAGATATAAAGCGTGGAAGATTCTCTTTCGAAGAAGAAGAAACCATTATTCAGCTTCATAGCTTTTTAGGAAACAAGTGGTCTGCGATTGCGGCGCGTTTGCCTGGAAGAACAGATAACGAGATCAAGAATTTCTGGAACACACATATAAGAAAGAAGTTGCTTAGAATGGGAATCGATCCAGTGACTCACAGTCCGCGACTCGATCTCCTCGACATCTCATCCATCTTAGCATCGTCTCTTTACAATTCCTCTTCACATCATGTGAACATGTCAAGACTCATGATGGATGCTCATCGTCAGCAGCAACAACATCCATTGGTTAACCCCGAGATACTCAAGCTCGCTACCTCTCTCTTCTCTCAAAACCAAAACCAAAACCAAAACCAGAACCAAAACCAAAACCAAAACTTCGTGGTGGATCATGAAGCGAAAACCCACGAGAACCACACGGTTTATCAACATGATGTCAACCAAACCGGAGTAAATCAATACCAAACCGACCATCAAGAACTTCAGTCTTGCATGCCGCCATTCCCCAATGAAGCTCAATATAACGACATGGATCATCAATTCAATGGTTTCGGAGAACTAAATCTCGCTACAACCTCCAATACGTTCAACGATTATGCAAGCTCTAGTTTTGTATTAGATCCTTCGTATTCAGAACGTAGCTTCAACTTCGCTAATTCGGTCTTGAACACGCCATCCTCGAGCCCGACTACGTTAAACTCCAGTTCCACGACTTACATCAACAGTAGCAGTTGCAGCACTGAGGATGAAATGGAAAGCTATTGCAGTAATCTCATGAAGTTTGATATTCCTGATTTCTTGGACGTTAATGGTTTTATTATATAA
Protein Sequence:
- >Tp7g19560|Thellungiella_parvula|MYB|Tp7g19560
MGRSPCCEKNGLKKGPWTSEEDQKLVEYIQKHGYGNWRTLPKNAGLQRCGKSCRLRWTNYLRPDIKRGRFSFEEEETIIQLHSFLGNKWSAIAARLPGRTDNEIKNFWNTHIRKKLLRMGIDPVTHSPRLDLLDISSILASSLYNSSSHHVNMSRLMMDAHRQQQQHPLVNPEILKLATSLFSQNQNQNQNQNQNQNQNFVVDHEAKTHENHTVYQHDVNQTGVNQYQTDHQELQSCMPPFPNEAQYNDMDHQFNGFGELNLATTSNTFNDYASSSFVLDPSYSERSFNFANSVLNTPSSSPTTLNSSSTTYINSSSCSTEDEMESYCSNLMKFDIPDFLDVNGFII