Information report for Tp57577_TGAC_v2_mRNA30253
Gene Details
|
|
Functional Annotation
- Refseq: XP_003624741.1 — transcription factor MYB52
- TrEMBL: A0A2Z6M069 — A0A2Z6M069_TRISU; Uncharacterized protein
- STRING: AES80959 — (Medicago truncatula)
- GO:0045893 — Biological Process — positive regulation of transcription, DNA-templated
- GO:0051782 — Biological Process — negative regulation of cell division
- GO:0071367 — Biological Process — cellular response to brassinosteroid stimulus
- GO:0005634 — Cellular Component — nucleus
- GO:0001046 — Molecular Function — core promoter sequence-specific DNA binding
Family Introduction
- MYB factors represent a family of proteins that include the conserved MYB DNA-binding domain.The first MYB gene identified was the ‘oncogene’ v-Myb derived from the avian myeloblastosis virus . Evidence obtained from sequence comparisons indicates that v-Myb may have originated from a vertebrate gene, which mutated once it became part of the virus. Many vertebrates contain three genes related to v-Myb c-Myb, A-Myb and B-Myb and other similar genes have been identified in insects, plants, fungi and slime moulds. The encoded proteins are crucial to the control of proliferation and differentiation in a number of cell types, and share the conserved MYB DNA-binding domain. This domain generally comprises up to three imperfect repeats, each forming a helix-turn-helix structure of about 53 amino acids. Three regularly spaced tryptophan residues, which form a tryptophan cluster in the three-dimensional helix-turn-helix structure, are characteristic of a MYB repeat. The three repeats in c-Myb are referred to as R1, R2 and R3; and repeats from other MYB proteins are categorised according to their similarity to either R1, R2 or R3.
- In contrast to animals, plants contain a MYB-protein subfamily that is characterised by the R2R3-type MYB domain. MYB proteins can be classified into three subfamilies depending on the number of adjacent repeats in the MYB domain (one, two or three). We refer to MYB-like proteins with one repeat as ‘MYB1R factors’, with two as ‘R2R3-type MYB’ factors, and with three repeats as ‘MYB3R’ factors.
Literature and News
Gene Resources
Homologs
- Cajanus cajan: C.cajan_17974, C.cajan_48027
- Cicer arietinum: XP_004493237.1, XP_004493238.1, XP_004493239.1
- Glycine max: Glyma.19G118500.1.p, Glyma.03G007500.1.p
- Gossypium arboreum: Cotton_A_30714_BGI-A2_v1.0
- Gossypium hirsutum: Gh_A11G2041
- Juglans regia: WALNUT_00001052-RA
- Lotus japonicus: Lj1g3v3992560.1
- Manihot esculenta: Manes.08G151800.1.p
- Medicago truncatula: Medtr7g086960.1
- Populus trichocarpa: Potri.019G040900.1
Sequences
CDS Sequence:
- >Tp57577_TGAC_v2_mRNA30253|Trifolium_pratense|MYB|Tp57577_TGAC_v2_mRNA30253
ATGATGAGTTCACAAAACTTCAACAATGGTCATATCACTGATATGGCTCTTTTCCCTTTAGCTCCTATTCCTCATTCTTCTCATTCTTTGACAAATCCTGAAATGGGTCTTCAGATTTTCAGACCCTCTTTGTTTCAGTCCAAAGAGATGAAGGAAACAAAGGAAGAAGATGTTTACTTTGGGATTCATAGCAAAAACTTGTCTTTGAAACTTGGTGATGAAGAAGTAGAAGAAAAAAGCTCTGTTTCTGTGAAGATTGGTTACTCCAAACTTTGTTCTAGAGGTCATTGGAGACCAGCTGAAGATGCAAAACTTAAGGAACTTGTTGCTGAATATGGTCCTCAAAATTGGAACTTGATTGCAGAACATCTTGATGGAAGATCAGTGTTTTTAATTCTAATTACAGGAAAAAGTTGCAGATTAAGGTGGTTTAATCAACTAGACCCAAGAATCAACAAAGGAACTTTTTCTGAGGAAGAAGAGGAAAGACTTTTAGCTGCTCATAAAATGTATGGTAACAAATGGGCTATGATTGCAAGACTTTTTCCAGGAAGAACAGATAATGCAGTGAAGAATCATTGGCATGTGATTATGGCTAGGAGGCATAGGGAACAGTGTAGTGTGTATAGAAGGAGAAAACCAGTTTTTGAAAGCATTTCAAAGGGTTTGAAATTGAGTCTTTCAAACAATGCAGCAAGTGATTCAACTATCTCAAGCACCATTGATGGAAATGCATCAGCTAGAACTAATCTCTCACTCACTCCATCTTCGGCTAATCTAAGTCCTCAACTGTTTCATAAACTTGTGACTCCAGTTCCGAATCACCAAGGCCATGGATCCCTAATTATGGGTAAGTCTAGAGAAAATGTGGTTGCAACTAGGGATGCAAGTTTTGACAAATATTTTGGAGCTAGTAAGAAGCAAGAGCAAGTGGAAAAGCTAAAGGTAATAGATGTGGTCCAGTCCAATTTTTCAGATTCAAACTCAGAAGTATCAGCATCTGAGTCAGTTACAACCAATAGGTCCAATATCTCAATTTCTGGTGAAAGTGAAAATATTGGTGCTAAGAATTTTAACATGTTACCATTCATTGATTTTCTTGGAGTAGGAGCTTTACACAGCTAA
Protein Sequence:
- >Tp57577_TGAC_v2_mRNA30253|Trifolium_pratense|MYB|Tp57577_TGAC_v2_mRNA30253
MMSSQNFNNGHITDMALFPLAPIPHSSHSLTNPEMGLQIFRPSLFQSKEMKETKEEDVYFGIHSKNLSLKLGDEEVEEKSSVSVKIGYSKLCSRGHWRPAEDAKLKELVAEYGPQNWNLIAEHLDGRSVFLILITGKSCRLRWFNQLDPRINKGTFSEEEEERLLAAHKMYGNKWAMIARLFPGRTDNAVKNHWHVIMARRHREQCSVYRRRKPVFESISKGLKLSLSNNAASDSTISSTIDGNASARTNLSLTPSSANLSPQLFHKLVTPVPNHQGHGSLIMGKSRENVVATRDASFDKYFGASKKQEQVEKLKVIDVVQSNFSDSNSEVSASESVTTNRSNISISGESENIGAKNFNMLPFIDFLGVGALHS*