Information report for Spipo2G0036500
Gene Details
|
|
Functional Annotation
- Refseq: XP_006659430.1 — PREDICTED: myb-related protein 308
- Swissprot: Q9LE63 — MY106_ARATH; Transcription factor MYB106
- TrEMBL: J3MT87 — J3MT87_ORYBR; Uncharacterized protein
- STRING: OB08G23170.1 — (Oryza brachyantha)
- GO:0000902 — Biological Process — cell morphogenesis
- GO:0009651 — Biological Process — response to salt stress
- GO:0009723 — Biological Process — response to ethylene
- GO:0009733 — Biological Process — response to auxin
- GO:0009739 — Biological Process — response to gibberellin
- GO:0009751 — Biological Process — response to salicylic acid
- GO:0009753 — Biological Process — response to jasmonic acid
- GO:0046686 — Biological Process — response to cadmium ion
- GO:0003677 — Molecular Function — DNA binding
Family Introduction
- MYB factors represent a family of proteins that include the conserved MYB DNA-binding domain.The first MYB gene identified was the ‘oncogene’ v-Myb derived from the avian myeloblastosis virus . Evidence obtained from sequence comparisons indicates that v-Myb may have originated from a vertebrate gene, which mutated once it became part of the virus. Many vertebrates contain three genes related to v-Myb c-Myb, A-Myb and B-Myb and other similar genes have been identified in insects, plants, fungi and slime moulds. The encoded proteins are crucial to the control of proliferation and differentiation in a number of cell types, and share the conserved MYB DNA-binding domain. This domain generally comprises up to three imperfect repeats, each forming a helix-turn-helix structure of about 53 amino acids. Three regularly spaced tryptophan residues, which form a tryptophan cluster in the three-dimensional helix-turn-helix structure, are characteristic of a MYB repeat. The three repeats in c-Myb are referred to as R1, R2 and R3; and repeats from other MYB proteins are categorised according to their similarity to either R1, R2 or R3.
- In contrast to animals, plants contain a MYB-protein subfamily that is characterised by the R2R3-type MYB domain. MYB proteins can be classified into three subfamilies depending on the number of adjacent repeats in the MYB domain (one, two or three). We refer to MYB-like proteins with one repeat as ‘MYB1R factors’, with two as ‘R2R3-type MYB’ factors, and with three repeats as ‘MYB3R’ factors.
Literature and News
Gene Resources
Homologs
- Brassica napus: GSBRNA2T00057212001, GSBRNA2T00017358001
- Brassica rapa: XP_009117713.1
- Gossypium arboreum: Cotton_A_05028_BGI-A2_v1.0
- Gossypium hirsutum: Gh_A10G1375, Gh_D10G1089
- Musa acuminata: GSMUA_Achr7P18410_001
- Oryza sativa: OsMYB106
- Panicum virgatum: Pavir.6KG271100.1.p
- Setaria italica: Seita.6G158000.3.p, Seita.6G158000.2.p, Seita.6G158000.1.p
- Setaria viridis: Sevir.6G164200.2.p, Sevir.6G164200.1.p
Sequences
CDS Sequence:
- >Spipo2G0036500|Spirodela_polyrhiza|MYB|Spipo2G0036500
ATGGGACGCTCGCCGTGCTGCGAGGAGGGCCTGAAGAAGGGGCCGTGGACGCCGGAGGAAGACCAGAAGCTGCTAGCCTACATCGACAGGAATGGGCACGGCAGCTGGCGGGCGCTGCCAGGCAGAGCCGGGCTGCAGAGATGCGGGAAGAGCTGCCGGCTTCGCTGGACGAATTACCTGCGGCCGGACATCAAGAGGGGCAAGTTCAGCTTGCAGGAGGAGCAGACAATAATCCAACTCCACGCTCTACTCGGCAACAGGTGGTCGGCGATCGCGTTGCACTTGCCGAAGAGGACGGACAACGAGATAAAGAACTTCTGGAACACTCACCTGAAGAAGCGGCTGGCGAAGATGGGCATTGACCCCGTCACCCACAAGCCAAGTTCCGACGCCGTTTCCACCATCGGCGGTGGCGCCGCCACCGCCGCCGCCGCCACCCTCAGCCACATGGCCCAGTGGGAGAGCGCCCGCCTTGAGGCCGAAGCCCGCCTCGCCAGAGAATCCAAAATGCTCCGTCCTTCTGCCGGCGCCGCCGCCGCCCATTTCCAGTCATCGACGGGGGCGGCCTTGTCGACATCGATGCCAATTCACCTCCAAAGCTCCTCCTCGTGCCCCTTGCCCACGCCGTGCCTTGACCTGGAGTCTCCCACTTCCACGCTGACCTTCTCCGAGAAGACAGAAAGCATCGTGAGGGGGACGGCCTTCTCCGACGGCCTTGCATGGCCTGTAGAGCAGTTAAGGATCGGATCGTTCTCGGCCTCGGCGGGCGCCGCCGTGGGGAGTCTAGGCGACGGGTTCGTGGAGATGTTACTCGGCGATTCCGACCGATTCCCCGCCGGCGACTGCACGGAGTTCACCGGCCATGGGAGAGCAAATGGCTACAACGACGAAGAAAGCAAGAGCTATTGGACCAACATACTGAACCTAGTCAACTCGGCTTCTCCCTCCAACTCGCCCGCCGGGTTCTAG
Protein Sequence:
- >Spipo2G0036500|Spirodela_polyrhiza|MYB|Spipo2G0036500
MGRSPCCEEGLKKGPWTPEEDQKLLAYIDRNGHGSWRALPGRAGLQRCGKSCRLRWTNYLRPDIKRGKFSLQEEQTIIQLHALLGNRWSAIALHLPKRTDNEIKNFWNTHLKKRLAKMGIDPVTHKPSSDAVSTIGGGAATAAAATLSHMAQWESARLEAEARLARESKMLRPSAGAAAAHFQSSTGAALSTSMPIHLQSSSSCPLPTPCLDLESPTSTLTFSEKTESIVRGTAFSDGLAWPVEQLRIGSFSASAGAAVGSLGDGFVEMLLGDSDRFPAGDCTEFTGHGRANGYNDEESKSYWTNILNLVNSASPSNSPAGF*