Information report for orange1.1g047012m
Gene Details
|
|
Functional Annotation
- Refseq: XP_006442689.1 — cell division cycle 5-like protein
- Swissprot: P92948 — CDC5L_ARATH; Cell division cycle 5-like protein
- TrEMBL: A0A067DSG9 — A0A067DSG9_CITSI; Uncharacterized protein
- STRING: XP_006442689.1 — (Citrus clementina)
- GO:0009870 — Biological Process — defense response signaling pathway, resistance gene-dependent
- GO:0010204 — Biological Process — defense response signaling pathway, resistance gene-independent
- GO:0042742 — Biological Process — defense response to bacterium
- GO:0050832 — Biological Process — defense response to fungus
- GO:0009507 — Cellular Component — chloroplast
- GO:0003677 — Molecular Function — DNA binding
Family Introduction
- MYB factors represent a family of proteins that include the conserved MYB DNA-binding domain.The first MYB gene identified was the ‘oncogene’ v-Myb derived from the avian myeloblastosis virus . Evidence obtained from sequence comparisons indicates that v-Myb may have originated from a vertebrate gene, which mutated once it became part of the virus. Many vertebrates contain three genes related to v-Myb c-Myb, A-Myb and B-Myb and other similar genes have been identified in insects, plants, fungi and slime moulds. The encoded proteins are crucial to the control of proliferation and differentiation in a number of cell types, and share the conserved MYB DNA-binding domain. This domain generally comprises up to three imperfect repeats, each forming a helix-turn-helix structure of about 53 amino acids. Three regularly spaced tryptophan residues, which form a tryptophan cluster in the three-dimensional helix-turn-helix structure, are characteristic of a MYB repeat. The three repeats in c-Myb are referred to as R1, R2 and R3; and repeats from other MYB proteins are categorised according to their similarity to either R1, R2 or R3.
- In contrast to animals, plants contain a MYB-protein subfamily that is characterised by the R2R3-type MYB domain. MYB proteins can be classified into three subfamilies depending on the number of adjacent repeats in the MYB domain (one, two or three). We refer to MYB-like proteins with one repeat as ‘MYB1R factors’, with two as ‘R2R3-type MYB’ factors, and with three repeats as ‘MYB3R’ factors.
Literature and News
Gene Resources
Homologs
- Actinidia chinensis: Achn076861
- Citrullus lanatus: Cla000783
- Gossypium arboreum: Cotton_A_12834_BGI-A2_v1.0
- Gossypium hirsutum: Gh_D13G1800, Gh_A13G1487, Gh_D11G2548, Gh_A11G2240
- Manihot esculenta: Manes.09G148400.1.p, Manes.08G139000.1.p
- Prunus mume: XP_008218318.1
- Prunus persica: Prupe.6G349400.1.p
- Ricinus communis: 29680.m001688
- Ziziphus jujuba: XP_015875562.1, XP_015875524.1
Sequences
CDS Sequence:
- >orange1.1g047012m|Citrus_sinensis|MYB|orange1.1g047012m
ATGAGGATTATGATCAAAGGAGGCGTGTGGAAGAACACGGAAGATGAGATCCTCAAAGCCGCCGTTATGAAATACGGCAAGAATCAGTGGGCCCGTATCTCCTCTCTCCTCGTTCGTAAATCCGCCAAGCAGTGCAAAGCTCGTTGGTACGAGTGGCTCGATCCCTCCATCAAAAAAACCGAATGGACGAGAGAGGAGGATGAGAAATTGCTTCATCTTGCCAAGCTTATGCCAACCCAGTGGAGAACAATTGCTCCAATTGTTGGCCGTACTCCCTCACAGTGCCTTGAGAGGTATGAGAAACTCCTTGATGCTGCCTGTGCCAAGGATGAGAACTATGAACCAGGTGATGATCCTCGAAAATTGCGTCCTGGGGAGATTGATCCAAACCCTGAATCAAAGCCTGCACGTCCAGATCCTGTTGATATGGATGAAGATGAGAAGGAAATGCTTTCTGAAGCACGAGCTCGTTTAGCCAACACTCGTGGCAAAAAGGCAAAAAGAAAGGCCAGGGAGAAACAGCTTGAAGAAGCCAGGAGGCTTGCTTCTTTGCAGAAAAGGAGAGAACTTAAAGCTGCTGGAATTGATACTAGGCAAAGGAAGAGAAAAAGGAGGGGTATCGACTATAATGCAGAAATCCCCTTTGAGAAGAAACCTCCTCCGGGTTTTTTTGATGTTACTGATGAAGATAGGCCTGTGGAACTAGTTAGCTTTCCAACAACCATTGAAGAGCTTGAAGGCAAGAGAAGAGTTGATATAGAAGCTCAGCTAAGAAGACAAGATATTGCAAAGAATAAAATTGCACAGAGGCAGGATGCTCCGTCGGCTATATTGCAGGCAAACAAGCTGAATGATCCGGAAACGGTTAGGAAGAGGTCAAAACTCATGCTTCCTGCTCCTCAGATATCAGACCATGAGTTGGAGGAAATTGCAAAAATGGGTTATGCTAGTGATCTTATTGCAGGGAATGAGGAACTGACGGAAGGAAGTGGTGCAACTCGTGCTCTTCTTGCAAATTATGCTCAGACACCACAGCGTGGAATGACACCATCACGAACTCCACAGAGAACCCCAGCTGGTAAGGGTGATGCTGTTATGATGGAAGCTGAAAACCTGGCCCGGATGAGAGAGTCTCAGACACCCTTGTTGGGGGGTGAGAACCCAGAGTTGCACCCTTCAGATTTTTCAGGGGGTCACTCCTAA
Protein Sequence:
- >orange1.1g047012m|Citrus_sinensis|MYB|orange1.1g047012m
MRIMIKGGVWKNTEDEILKAAVMKYGKNQWARISSLLVRKSAKQCKARWYEWLDPSIKKTEWTREEDEKLLHLAKLMPTQWRTIAPIVGRTPSQCLERYEKLLDAACAKDENYEPGDDPRKLRPGEIDPNPESKPARPDPVDMDEDEKEMLSEARARLANTRGKKAKRKAREKQLEEARRLASLQKRRELKAAGIDTRQRKRKRRGIDYNAEIPFEKKPPPGFFDVTDEDRPVELVSFPTTIEELEGKRRVDIEAQLRRQDIAKNKIAQRQDAPSAILQANKLNDPETVRKRSKLMLPAPQISDHELEEIAKMGYASDLIAGNEELTEGSGATRALLANYAQTPQRGMTPSRTPQRTPAGKGDAVMMEAENLARMRESQTPLLGGENPELHPSDFSGGHS*