Information report for MELO3C022213P1
Gene Details
|
|
Functional Annotation
- Refseq: XP_008459665.1 — PREDICTED: transcription repressor MYB6-like
- Swissprot: Q38851 — MYB6_ARATH; Transcription repressor MYB6
- TrEMBL: A0A1S3CB73 — A0A1S3CB73_CUCME; transcription repressor MYB6-like
- STRING: XP_008459665.1 — (Cucumis melo)
- GO:0009739 — Biological Process — response to gibberellin
- GO:0009751 — Biological Process — response to salicylic acid
- GO:0009753 — Biological Process — response to jasmonic acid
- GO:0090378 — Biological Process — seed trichome elongation
- GO:0003677 — Molecular Function — DNA binding
Family Introduction
- MYB factors represent a family of proteins that include the conserved MYB DNA-binding domain.The first MYB gene identified was the ‘oncogene’ v-Myb derived from the avian myeloblastosis virus . Evidence obtained from sequence comparisons indicates that v-Myb may have originated from a vertebrate gene, which mutated once it became part of the virus. Many vertebrates contain three genes related to v-Myb c-Myb, A-Myb and B-Myb and other similar genes have been identified in insects, plants, fungi and slime moulds. The encoded proteins are crucial to the control of proliferation and differentiation in a number of cell types, and share the conserved MYB DNA-binding domain. This domain generally comprises up to three imperfect repeats, each forming a helix-turn-helix structure of about 53 amino acids. Three regularly spaced tryptophan residues, which form a tryptophan cluster in the three-dimensional helix-turn-helix structure, are characteristic of a MYB repeat. The three repeats in c-Myb are referred to as R1, R2 and R3; and repeats from other MYB proteins are categorised according to their similarity to either R1, R2 or R3.
- In contrast to animals, plants contain a MYB-protein subfamily that is characterised by the R2R3-type MYB domain. MYB proteins can be classified into three subfamilies depending on the number of adjacent repeats in the MYB domain (one, two or three). We refer to MYB-like proteins with one repeat as ‘MYB1R factors’, with two as ‘R2R3-type MYB’ factors, and with three repeats as ‘MYB3R’ factors.
Literature and News
Gene Resources
Homologs
- Actinidia chinensis: Achn372141
- Citrullus lanatus: Cla012519
- Cucumis sativus: Cucsa.061660.2, Cucsa.061660.1
- Fragaria vesca: mrna25685.1-v1.0-hybrid
- Gossypium arboreum: Cotton_A_03997_BGI-A2_v1.0, Cotton_A_33049_BGI-A2_v1.0
- Gossypium hirsutum: Gh_A13G1009, Gh_D05G2607, Gh_A05G2342, Gh_D13G1257
- Juglans regia: WALNUT_00027679-RA
- Manihot esculenta: Manes.02G194800.1.p
- Nicotiana benthamiana: Niben101Scf04117g07003.1
- Nicotiana tabacum: XP_016445389.1, XP_016485029.1
- Prunus mume: XP_008219033.1
- Prunus persica: Prupe.1G551400.1.p
- Ricinus communis: 28154.m000040
- Ziziphus jujuba: XP_015886343.1, XP_015886342.1
Sequences
CDS Sequence:
- >MELO3C022213P1|Cucumis_melo|MYB|MELO3C022213P1
ATGGGGAGATCCCCTTGCTGTGAGAAAGCCCACACCAACAAAGGTGCTTGGACCAAAGATGAAGATCAACGCCTCATCGATTACATTCGCCTCCATGGTGAAGGCTGTTGGCGTACTCTCCCTAAGGCTGCTGGATTGCTTCGTTGTGGCAAAAGCTGTAGGCTTCGTTGGATCAATTACCTTCGTCCTGATCTCAAACGTGGCAATTTCACTGAAGATGAAGATGAACTCATCATCAGACTCCATTCCCTTCTTGGAAACAAATGGTCTGTGATTGCGGGTAAATTACCTGGAAGAACAGATAACGAAATCAAAAACTATTGGAACACTCACATCAAGAGAAAACTCATCACCCGTGGCATCGATCCACAAACCCACCGCCCTCTTAACGAACCCCCCACCGCCGGCACCGCCCTCTCCCCACGTTTGCCTTACCAGAGTCATCACCATCATCGTCGTCATCATCAGCATCTCACGCCCAACCATTCCTCCTCTTCTTCCTCCTCTCTTCCCAACATCGCAGAACTTCCGATTGTGAAGCCTGCAAACAACGTCCACTCCTCCGACGCCGACGAAGAAGGAAGCGGGACCACCACGGAGATGGATCCGCCGGTGGCTGCGGCGGAAACCATGTTGGGAGTCCATGTGAAAACAGAGGTGAATTTGGAGCTCTCAATTGGGCTGCAACCATTTCAGGGAGAGGGGGTGAGGGGAGGGTCAGTACTGGGGAGCTCGGCAGAGTCGAGATTGCGAGAAGAGAGAAGGGCGTTGGTGATGTGCTTGTGCTGGCAATTGGGATGGGAGAAGGGCGGGGAGAGTTGCCGGAATTGTGAGAGGACGTACGGGTGGTTCCGGGGAAGTGCTTTGGGTTCTTCTTCATAG
Protein Sequence:
- >MELO3C022213P1|Cucumis_melo|MYB|MELO3C022213P1
MGRSPCCEKAHTNKGAWTKDEDQRLIDYIRLHGEGCWRTLPKAAGLLRCGKSCRLRWINYLRPDLKRGNFTEDEDELIIRLHSLLGNKWSVIAGKLPGRTDNEIKNYWNTHIKRKLITRGIDPQTHRPLNEPPTAGTALSPRLPYQSHHHHRRHHQHLTPNHSSSSSSSLPNIAELPIVKPANNVHSSDADEEGSGTTTEMDPPVAAAETMLGVHVKTEVNLELSIGLQPFQGEGVRGGSVLGSSAESRLREERRALVMCLCWQLGWEKGGESCRNCERTYGWFRGSALGSSS*