Information report for MELO3C014597P1
Gene Details
|
|
Functional Annotation
- Refseq: XP_008449719.1 — PREDICTED: transcription factor MYB46
- TrEMBL: A0A1S3BNB2 — A0A1S3BNB2_CUCME; transcription factor MYB46
- STRING: XP_008449719.1 — (Cucumis melo)
- GO:0009751 — Biological Process — response to salicylic acid
- GO:0045893 — Biological Process — positive regulation of transcription, DNA-templated
- GO:0050832 — Biological Process — defense response to fungus
- GO:1901348 — Biological Process — positive regulation of secondary cell wall biogenesis
- GO:0005634 — Cellular Component — nucleus
- GO:0003677 — Molecular Function — DNA binding
- GO:0003700 — Molecular Function — transcription factor activity, sequence-specific DNA binding
Family Introduction
- MYB factors represent a family of proteins that include the conserved MYB DNA-binding domain.The first MYB gene identified was the ‘oncogene’ v-Myb derived from the avian myeloblastosis virus . Evidence obtained from sequence comparisons indicates that v-Myb may have originated from a vertebrate gene, which mutated once it became part of the virus. Many vertebrates contain three genes related to v-Myb c-Myb, A-Myb and B-Myb and other similar genes have been identified in insects, plants, fungi and slime moulds. The encoded proteins are crucial to the control of proliferation and differentiation in a number of cell types, and share the conserved MYB DNA-binding domain. This domain generally comprises up to three imperfect repeats, each forming a helix-turn-helix structure of about 53 amino acids. Three regularly spaced tryptophan residues, which form a tryptophan cluster in the three-dimensional helix-turn-helix structure, are characteristic of a MYB repeat. The three repeats in c-Myb are referred to as R1, R2 and R3; and repeats from other MYB proteins are categorised according to their similarity to either R1, R2 or R3.
- In contrast to animals, plants contain a MYB-protein subfamily that is characterised by the R2R3-type MYB domain. MYB proteins can be classified into three subfamilies depending on the number of adjacent repeats in the MYB domain (one, two or three). We refer to MYB-like proteins with one repeat as ‘MYB1R factors’, with two as ‘R2R3-type MYB’ factors, and with three repeats as ‘MYB3R’ factors.
Literature and News
Gene Resources
Homologs
- Cajanus cajan: C.cajan_48179, C.cajan_39983, C.cajan_26473
- Cicer arietinum: XP_004507092.1
- Citrullus lanatus: Cla008544
- Cucumis sativus: Cucsa.065530.1
- Glycine max: Glyma.11G133700.1.p, Glyma.12G057900.1.p
- Lotus japonicus: Lj0g3v0276369.1
- Manihot esculenta: Manes.06G164800.1.p
- Medicago truncatula: Medtr2g097910.1, Medtr4g065017.1
- Populus trichocarpa: Potri.009G053900.1
- Pyrus bretschneideri: Pbr036591.1, Pbr036590.1
- Vitis vinifera: GSVIVT01025269001
- Ziziphus jujuba: XP_015875882.1, XP_015875881.1
Sequences
CDS Sequence:
- >MELO3C014597P1|Cucumis_melo|MYB|MELO3C014597P1
ATGAGGAAGCCAGAGACAACGGGTGCGAGCAGTGGCACGACGATAACGAAGCTCCGGAAAGGACTCTGGTCTCCTGAAGAAGATGATAAGTTGATGAGCTATATGCTTAACAATGGCCAAGGCTGTTGGAGCGATGTTGCTCGTAATGCAGGTCTTCAACGTTGCGGTAAGAGCTGTCGTCTACGTTGGATCAATTACTTACGCCCTGATCTCAAACGTGGAGCTTTCTCTCCCCAAGAAGAACACCTTATCATACATTTGCATTCTCTTCTTGGAAACAGATGGTCTCAAATTGCCGCACGATTACCGGGAAGAACCGATAACGAAATCAAGAACTTTTGGAACTCCACCATTAAAAAGAGGCTCAAGAATTTGTCCTCAACACCATCACCAAACACCAGCTCCACCGGCTCCCCCTCTACAGACTCAAAACCTAACCTTTTTGGTGGCCTCTTATCGACTCAAGACCAACAACAACAATCACAAGGCTTAATGGATGAGTTCCCCATCTATGCTTCGGATCCTATTATCGGTCTCGATCCTTTCCCTTTCATCTCCGCCCACAGTGGACCATTCTTCTCCACCACCACCTCGACCTTCACCGGGGTCGAACCGAGTTTTTTCCATGAAGATCATGAGAGTTTCTTTAGTAATCTCCCTCTTTTGCAGAGTGTTAACAACACCACCACCGTCACTGCCACCACTGTCGTCGAGAGAAGCTTAAAAAATGAAACCATAGTTAAAGAAGCTAACCATAGTAATTACTTAATTAACAACATCAACTGCCTTGCTAATCATAATAATTTTAGCAACAATAATAATCCAAAGACTGATAACAACATTAATGGTGGTGGGGTTGGAGCAAATAATTTTCTTCATGAGGAATTTTCAATTGGGGAATGGGACTTGGACGATTTGATGAAAGATGTTCCTTCTTTCCCATGTCTCAATTTTCAAGTCCAATAG
Protein Sequence:
- >MELO3C014597P1|Cucumis_melo|MYB|MELO3C014597P1
MRKPETTGASSGTTITKLRKGLWSPEEDDKLMSYMLNNGQGCWSDVARNAGLQRCGKSCRLRWINYLRPDLKRGAFSPQEEHLIIHLHSLLGNRWSQIAARLPGRTDNEIKNFWNSTIKKRLKNLSSTPSPNTSSTGSPSTDSKPNLFGGLLSTQDQQQQSQGLMDEFPIYASDPIIGLDPFPFISAHSGPFFSTTTSTFTGVEPSFFHEDHESFFSNLPLLQSVNNTTTVTATTVVERSLKNETIVKEANHSNYLINNINCLANHNNFSNNNNPKTDNNINGGGVGANNFLHEEFSIGEWDLDDLMKDVPSFPCLNFQVQ*