Information report for MDP0000807341
Gene Details
|
|
Functional Annotation
- Refseq: NP_001288045.1 — transcription factor MYB86-like
- Swissprot: Q42575 — MYB1_ARATH; Transcription factor MYB1
- TrEMBL: A0FK20 — A0FK20_MALDO; MYB domain class transcription factor
- STRING: XP_008381854.1 — (Malus domestica)
- GO:0009651 — Biological Process — response to salt stress
- GO:0009723 — Biological Process — response to ethylene
- GO:0009733 — Biological Process — response to auxin
- GO:0009737 — Biological Process — response to abscisic acid
- GO:0009739 — Biological Process — response to gibberellin
- GO:0009751 — Biological Process — response to salicylic acid
- GO:0009753 — Biological Process — response to jasmonic acid
- GO:0005634 — Cellular Component — nucleus
- GO:0005737 — Cellular Component — cytoplasm
- GO:0003677 — Molecular Function — DNA binding
Family Introduction
- MYB factors represent a family of proteins that include the conserved MYB DNA-binding domain.The first MYB gene identified was the ‘oncogene’ v-Myb derived from the avian myeloblastosis virus . Evidence obtained from sequence comparisons indicates that v-Myb may have originated from a vertebrate gene, which mutated once it became part of the virus. Many vertebrates contain three genes related to v-Myb c-Myb, A-Myb and B-Myb and other similar genes have been identified in insects, plants, fungi and slime moulds. The encoded proteins are crucial to the control of proliferation and differentiation in a number of cell types, and share the conserved MYB DNA-binding domain. This domain generally comprises up to three imperfect repeats, each forming a helix-turn-helix structure of about 53 amino acids. Three regularly spaced tryptophan residues, which form a tryptophan cluster in the three-dimensional helix-turn-helix structure, are characteristic of a MYB repeat. The three repeats in c-Myb are referred to as R1, R2 and R3; and repeats from other MYB proteins are categorised according to their similarity to either R1, R2 or R3.
- In contrast to animals, plants contain a MYB-protein subfamily that is characterised by the R2R3-type MYB domain. MYB proteins can be classified into three subfamilies depending on the number of adjacent repeats in the MYB domain (one, two or three). We refer to MYB-like proteins with one repeat as ‘MYB1R factors’, with two as ‘R2R3-type MYB’ factors, and with three repeats as ‘MYB3R’ factors.
Literature and News
Gene Resources
Homologs
- Citrus sinensis: orange1.1g012494m
- Fragaria vesca: mrna20888.1-v1.0-hybrid
- Gossypium arboreum: Cotton_A_13543_BGI-A2_v1.0
- Gossypium hirsutum: Gh_D10G2478, Gh_A10G2052
- Juglans regia: WALNUT_00006259-RA
- Manihot esculenta: Manes.10G019700.1.p
- Populus trichocarpa: Potri.010G195000.1, Potri.008G062700.1
- Prunus mume: XP_008233695.1
- Prunus persica: Prupe.2G244100.1.p
- Pyrus bretschneideri: Pbr009464.1, Pbr011369.1
- Vitis vinifera: GSVIVT01016393001, GSVIVT01034041001
- Ziziphus jujuba: XP_015877330.1
Sequences
CDS Sequence:
- >MDP0000807341|Malus_domestica|MYB|MDP0000807341
ATGACGGCCCCAAACGGCGCCGTCCCCAAACAAGCCGACGACCGCCCCGGCACCGAGGCCGAGTTGAACGAGGGCGCAGTGCCCAACGGGAAAGTGAGGGGACCGTGGTCGCCCGAGGAGGACGCGGTGCTGAGCCGGCTCGTGAGCAACTTCGGGGCGAGGAATTGGAGCCTGATCGCCCGAGGAATTCCCGGACGGTCTGGGAAGTCGTGCCGGCTGAGGTGGTGTAATCAGCTTGACCCCTGCGTCAAGCGTAAACCCTTTTCTGAGGAAGAAGACCGTATTATAGTTTCAGCACATGCTATCCATGGGAACAAATGGGCAGTAATTGCAAAGCTTCTTCCAGGTAGAACAGATAACGGAATCAAGAACCATTGGAATTCTACACTAAGGCGCAAGTGCTTTGATAAAGGAAGGTTTAATACTGGACCTGGGGAAATGATGGAAGATGACACCTTTGACAGAAAAAATGCATCCTCAGAAGAAACCCTGTCAGTTGGGAATATCAGTTCATTCAAGACTCATGAAGGAAGAGAGGTCTTGATGGAAAATAGACCAAACCAGTTCGATGTAAGAAGTCATGCAAAGGAGGGCTCTGGCGCTGCCGAATCAAAGCACAATTCTACTCTTATTGCCGAGCCAAGAGACCATCCGACTCTCCAGTCCACCATTTGTTGTCCAGTGGCACGTGTTAGTGCATTTAGTGTTTATAACCGTCCAAGTGTTCCAGCAAATGCTTCATCGTTGTCAAGGACAGTCCCAAGTCATGGCCCTTTGGTCCCAATAACTAAACTAGATTTCGGCTTTGACAACTTCCTTGAAGGTGCATGCAATGAGCCTACGGTTCCTCAACGCTGTGGTCACGGTTGCTGTGATCGAATTGAGGGGCATTCTCAAAGCTCGTTGTTGGGGCCTGAGTTCGTTGAGTATGATGAGCCTCTCCCTTTCTCTAGCCACGAATTAATCTCCATTGCTACGGATTTGAACAAGATTGCATGGATTAAGGGTGGCCTTGAGAGTAATGGGATAAGGATGCCAGAGCACGTAGCAAGCCAGAGAGTCTTTCAAGCAGCTGCCACTACCTTGCAAATGGGGTTGCCAGCAAACACTCCGATGAATGACCATATGCGCTTTGAGGAAGGAAGAAACAAGTTGATGGGAATGATGACGGACGTGCTATCAACCCAGGTGCCTAGACAAACTTTTGCAATGCCAACTGAAGTTGAGGGATTGAGCTAG
Protein Sequence:
- >MDP0000807341|Malus_domestica|MYB|MDP0000807341
MTAPNGAVPKQADDRPGTEAELNEGAVPNGKVRGPWSPEEDAVLSRLVSNFGARNWSLIARGIPGRSGKSCRLRWCNQLDPCVKRKPFSEEEDRIIVSAHAIHGNKWAVIAKLLPGRTDNGIKNHWNSTLRRKCFDKGRFNTGPGEMMEDDTFDRKNASSEETLSVGNISSFKTHEGREVLMENRPNQFDVRSHAKEGSGAAESKHNSTLIAEPRDHPTLQSTICCPVARVSAFSVYNRPSVPANASSLSRTVPSHGPLVPITKLDFGFDNFLEGACNEPTVPQRCGHGCCDRIEGHSQSSLLGPEFVEYDEPLPFSSHELISIATDLNKIAWIKGGLESNGIRMPEHVASQRVFQAAATTLQMGLPANTPMNDHMRFEEGRNKLMGMMTDVLSTQVPRQTFAMPTEVEGLS*