Information report for Gh_A04G1412
Gene Details
|
|
Functional Annotation
- Refseq: XP_012459337.1 — PREDICTED: transcription factor DIVARICATA-like
- Refseq: XP_012459338.1 — PREDICTED: transcription factor DIVARICATA-like
- Refseq: XP_012459340.1 — PREDICTED: transcription factor DIVARICATA-like
- Refseq: XP_012459341.1 — PREDICTED: transcription factor DIVARICATA-like
- Refseq: XP_012459342.1 — PREDICTED: transcription factor DIVARICATA-like
- Refseq: XP_012459343.1 — PREDICTED: transcription factor DIVARICATA-like
- Refseq: XP_012459344.1 — PREDICTED: transcription factor DIVARICATA-like
- Refseq: XP_012459345.1 — PREDICTED: transcription factor DIVARICATA-like
- Refseq: XP_012459346.1 — PREDICTED: transcription factor DIVARICATA-like
- Refseq: XP_012459347.1 — PREDICTED: transcription factor DIVARICATA-like
- Refseq: XP_012459348.1 — PREDICTED: transcription factor DIVARICATA-like
- Refseq: XP_012459349.1 — PREDICTED: transcription factor DIVARICATA-like
- Refseq: XP_012459351.1 — PREDICTED: transcription factor DIVARICATA-like
- Refseq: XP_012459352.1 — PREDICTED: transcription factor DIVARICATA-like
- Swissprot: Q9FNN6 — SRM1_ARATH; Transcription factor SRM1
- TrEMBL: A0A0B0PST5 — A0A0B0PST5_GOSAR; Transcription factor MYB1R1
- STRING: Gorai.012G135600.1 — (Gossypium raimondii)
- GO:0003677 — Molecular Function — DNA binding
Family Introduction
- MYB factors represent a family of proteins that include the conserved MYB DNA-binding domain.The first MYB gene identified was the ‘oncogene’ v-Myb derived from the avian myeloblastosis virus . Evidence obtained from sequence comparisons indicates that v-Myb may have originated from a vertebrate gene, which mutated once it became part of the virus. Many vertebrates contain three genes related to v-Myb c-Myb, A-Myb and B-Myb and other similar genes have been identified in insects, plants, fungi and slime moulds. The encoded proteins are crucial to the control of proliferation and differentiation in a number of cell types, and share the conserved MYB DNA-binding domain. This domain generally comprises up to three imperfect repeats, each forming a helix-turn-helix structure of about 53 amino acids. Three regularly spaced tryptophan residues, which form a tryptophan cluster in the three-dimensional helix-turn-helix structure, are characteristic of a MYB repeat. The three repeats in c-Myb are referred to as R1, R2 and R3; and repeats from other MYB proteins are categorised according to their similarity to either R1, R2 or R3.
- In contrast to animals, plants contain a MYB-protein subfamily that is characterised by the R2R3-type MYB domain. MYB proteins can be classified into three subfamilies depending on the number of adjacent repeats in the MYB domain (one, two or three). We refer to MYB-like proteins with one repeat as ‘MYB1R factors’, with two as ‘R2R3-type MYB’ factors, and with three repeats as ‘MYB3R’ factors.
Literature and News
Gene Resources
Homologs
- Gossypium arboreum: Cotton_A_29819_BGI-A2_v1.0, Cotton_A_26473_BGI-A2_v1.0
Sequences
CDS Sequence:
- >Gh_A04G1412|Gossypium_hirsutum|MYB|Gh_A04G1412
ATGACCGTGGAGGAAGCCGATAGCAGCTCCAAGTGGAGTAGGGAGCAAGATAAGGCATTTGAGAATGCTCTTGCAACTTATCCTGAGGACTCTTCAGATCGATGGGAGAAAATTGCAGCTGATGTACCTGGAAAAACTTTGGAAGAGATTAAAGAACACTATGAGCTTCTAGAGGATGATGTTAACCGGATTGAATCTGGTTGTGTGCCTCTGCCGCCATATAATTCTTCCGAGAGTTCAGCAGGAGATGAAGGAGCTGGTAAGAAGGGGAGCAGCCATTCAGGGAATTGTAACAGTGAGTCAAATCATGGGAGTAAGAATTCAAGGTCAGATCAAGAACGTCGGAAGGGGATTGCTTGGACAGAGGATGAGCACAGGTTATTTCTTCTTGGTCTGGATAAATACGGGAAAGGTGACTGGCGAAGCATATCCCGGAACTTTGTGGTCACAAGAACGCCAACACAAGTAGCAAGTCATGCGCAAAAATATTTCATTAGATTGAACTCAATGAACAAAGATCAAAGGCGATCTAGCATCCATGACATTACCAGTGTTGGCAATGGGGATGTTTCAGCACCCCAAGGTCCGATCACTGGTCAATCAAATGGCACCGCATCTGTGGGTTCTGCAGCAAAATCAACCAAACAGCCGCTCGGACATTCTGTTGCACCACCCGGTATCAGTGTGCATGGAGTTCCAACTATGGGGCAACCAATAGGTCCCCTCATCTCAGCAGTTGGCACGCCAGTGAACCTTCCTGCTCCGGCACATATGGCTTACGGAGTCAGAGCAACATTACCAGGAGCAGTGGTTCCAGGTGCACCCGTGACATACCCTATGCCTTATACATCTGCTCATAGGTAA
Protein Sequence:
- >Gh_A04G1412|Gossypium_hirsutum|MYB|Gh_A04G1412
MTVEEADSSSKWSREQDKAFENALATYPEDSSDRWEKIAADVPGKTLEEIKEHYELLEDDVNRIESGCVPLPPYNSSESSAGDEGAGKKGSSHSGNCNSESNHGSKNSRSDQERRKGIAWTEDEHRLFLLGLDKYGKGDWRSISRNFVVTRTPTQVASHAQKYFIRLNSMNKDQRRSSIHDITSVGNGDVSAPQGPITGQSNGTASVGSAAKSTKQPLGHSVAPPGISVHGVPTMGQPIGPLISAVGTPVNLPAPAHMAYGVRATLPGAVVPGAPVTYPMPYTSAHR