Information report for EMT21654
Gene Details
Functional Annotation
- Refseq: XP_020178661.1 — transcription factor MYB6-like
- Swissprot: Q9LDR8 — MY102_ARATH; Transcription factor MYB102
- TrEMBL: M8BI57 — M8BI57_AEGTA; Transcription factor MYB39
- STRING: EMT21654 — (Aegilops tauschii)
- GO:0006355 — Biological Process — regulation of transcription, DNA-templated
- GO:0009414 — Biological Process — response to water deprivation
- GO:0009611 — Biological Process — response to wounding
- GO:0009733 — Biological Process — response to auxin
- GO:0009738 — Biological Process — abscisic acid-activated signaling pathway
- GO:0009867 — Biological Process — jasmonic acid mediated signaling pathway
- GO:0042538 — Biological Process — hyperosmotic salinity response
- GO:0003677 — Molecular Function — DNA binding
- GO:0003700 — Molecular Function — transcription factor activity, sequence-specific DNA binding
Family Introduction
- MYB factors represent a family of proteins that include the conserved MYB DNA-binding domain.The first MYB gene identified was the ‘oncogene’ v-Myb derived from the avian myeloblastosis virus . Evidence obtained from sequence comparisons indicates that v-Myb may have originated from a vertebrate gene, which mutated once it became part of the virus. Many vertebrates contain three genes related to v-Myb c-Myb, A-Myb and B-Myb and other similar genes have been identified in insects, plants, fungi and slime moulds. The encoded proteins are crucial to the control of proliferation and differentiation in a number of cell types, and share the conserved MYB DNA-binding domain. This domain generally comprises up to three imperfect repeats, each forming a helix-turn-helix structure of about 53 amino acids. Three regularly spaced tryptophan residues, which form a tryptophan cluster in the three-dimensional helix-turn-helix structure, are characteristic of a MYB repeat. The three repeats in c-Myb are referred to as R1, R2 and R3; and repeats from other MYB proteins are categorised according to their similarity to either R1, R2 or R3.
- In contrast to animals, plants contain a MYB-protein subfamily that is characterised by the R2R3-type MYB domain. MYB proteins can be classified into three subfamilies depending on the number of adjacent repeats in the MYB domain (one, two or three). We refer to MYB-like proteins with one repeat as ‘MYB1R factors’, with two as ‘R2R3-type MYB’ factors, and with three repeats as ‘MYB3R’ factors.
Literature and News
Gene Resources
Homologs
- Brachypodium distachyon: Bradi1g24887.1.p
- Glycine max: Glyma.15G066800.1.p, Glyma.13G247200.1.p
- Hordeum vulgare: MLOC_62436.1
- Oryza sativa: OsMYB7
- Panicum virgatum: Pavir.2KG486500.1.p
- Setaria italica: Seita.2G351400.1.p
- Setaria viridis: Sevir.2G362200.1.p
- Triticum aestivum: Traes_2AS_FA7059723.1, Traes_2DS_49959692B1.1, Traes_2DS_49959692B.1
- Zea mays: GRMZM2G166337_P01, GRMZM2G031323_P01
Sequences
CDS Sequence:
- >EMT21654|Aegilops_tauschii|MYB|EMT21654
ATGGGGCGCGCGCCGTGCTGCGACAGGACCGGGCTCAAGAAGGGGCCGTGGACGCAGGAGGAGGACGAGAAGCTCATCGCCTACATCAAGAAGCACGGCCAGGGCAACTGGCGCACCCTCCCCAAGGATGCCGACCTGGAGCGGTGCGGGAAGAGCTGCCGGCTGCGGTGGACCAACTACCTCCGGCCGGACATCAAGCGCGGCCGCTTCTCCTTCGAGGAGGAGGAGACCATCATCCAGCTCCACAGCATCCTCGGCAACAAGTGGTCAGCCATTGCGGCGAGGCTGCCCGGACGGACGGACAACGAGATCAAGAACTACTGGAACACGCACATCCGCAAGCGCCTCCTCCGCATGGGCATCGACCCCGTCACCCACGCGCCGCGCCTCGACCTCCTCGACCTCTCCTCGCTCCTCAAGCCTGCCGCCTACTACCCCACGCAGGCCGACCTCGACACGCTCCGCGCCTTCGAGCCGCTCGCCAACTACCCGGACCTCCTCCGCCTCGCCTCCACCCTCCTCGCAGCCCACGACCCAACAGCAGATGCTCCTCCCTTGGCTGATCCAGGCGCAGATGGCGCAGCAGACATGTTCTTGCAGCCCAGCTCGGCGTGCCAAATGCCGGGCCTGGTTCACGCGAACCCCGCGCAGCAACTACACCAGGATCACGTGGTGGCCTCTGACTACGGGCAGCTCCCGGGCTACGACAACCAGCTCGAGCTCGACTACGTGCCGGCGCTGATGCAGATGGCGTCAGACACGTCGAACCTGCAGTGGAGCAGCCCGGTCACAAGTAGCAACAACAACAACTGCAACGTCGGCTCCGGCGTATCCACGCCGTCATCGAGCCCCGCCGGGCGTGTGAACTCGGCTTCAACGGCAGCGGTCTGCGCCAACACGAGCAATATTGACGCCTTCAGCGCCGACGCCGCCGGGCTGTTCGACATGCACCTGTCCGATCTCCTGGATGTGAGCGACTACATGTAG
Protein Sequence:
- >EMT21654|Aegilops_tauschii|MYB|EMT21654
MGRAPCCDRTGLKKGPWTQEEDEKLIAYIKKHGQGNWRTLPKDADLERCGKSCRLRWTNYLRPDIKRGRFSFEEEETIIQLHSILGNKWSAIAARLPGRTDNEIKNYWNTHIRKRLLRMGIDPVTHAPRLDLLDLSSLLKPAAYYPTQADLDTLRAFEPLANYPDLLRLASTLLAAHDPTADAPPLADPGADGAADMFLQPSSACQMPGLVHANPAQQLHQDHVVASDYGQLPGYDNQLELDYVPALMQMASDTSNLQWSSPVTSSNNNNCNVGSGVSTPSSSPAGRVNSASTAAVCANTSNIDAFSADAAGLFDMHLSDLLDVSDYM