Information report for Cla017496
Gene Details
Functional Annotation
- Refseq: XP_011652133.1 — PREDICTED: transcription factor MYB44
- TrEMBL: A0A0A0LEK9 — A0A0A0LEK9_CUCSA; Uncharacterized protein
- STRING: XP_008443134.1 — (Cucumis melo)
- GO:0045893 — Biological Process — positive regulation of transcription, DNA-templated
- GO:0051782 — Biological Process — negative regulation of cell division
- GO:0071367 — Biological Process — cellular response to brassinosteroid stimulus
- GO:0005634 — Cellular Component — nucleus
- GO:0001046 — Molecular Function — core promoter sequence-specific DNA binding
Family Introduction
- MYB factors represent a family of proteins that include the conserved MYB DNA-binding domain.The first MYB gene identified was the ‘oncogene’ v-Myb derived from the avian myeloblastosis virus . Evidence obtained from sequence comparisons indicates that v-Myb may have originated from a vertebrate gene, which mutated once it became part of the virus. Many vertebrates contain three genes related to v-Myb c-Myb, A-Myb and B-Myb and other similar genes have been identified in insects, plants, fungi and slime moulds. The encoded proteins are crucial to the control of proliferation and differentiation in a number of cell types, and share the conserved MYB DNA-binding domain. This domain generally comprises up to three imperfect repeats, each forming a helix-turn-helix structure of about 53 amino acids. Three regularly spaced tryptophan residues, which form a tryptophan cluster in the three-dimensional helix-turn-helix structure, are characteristic of a MYB repeat. The three repeats in c-Myb are referred to as R1, R2 and R3; and repeats from other MYB proteins are categorised according to their similarity to either R1, R2 or R3.
- In contrast to animals, plants contain a MYB-protein subfamily that is characterised by the R2R3-type MYB domain. MYB proteins can be classified into three subfamilies depending on the number of adjacent repeats in the MYB domain (one, two or three). We refer to MYB-like proteins with one repeat as ‘MYB1R factors’, with two as ‘R2R3-type MYB’ factors, and with three repeats as ‘MYB3R’ factors.
Literature and News
Gene Resources
Homologs
- Cucumis melo: MELO3C009678P1
- Cucumis sativus: Cucsa.337000.1
- Gossypium arboreum: Cotton_A_30714_BGI-A2_v1.0
- Gossypium hirsutum: Gh_A11G2041, Gh_D11G2347, Gh_A11G2677
- Juglans regia: WALNUT_00001052-RA
- Manihot esculenta: Manes.08G151800.1.p, Manes.09G136100.1.p
- Nicotiana attenuata: A4A49_29942
- Nicotiana benthamiana: Niben101Scf03018g03003.1
- Nicotiana tabacum: XP_016513931.1
- Populus trichocarpa: Potri.019G040900.1
- Ziziphus jujuba: XP_015899736.1
Sequences
CDS Sequence:
- >Cla017496|Citrullus_lanatus|MYB|Cla017496
ATGAACCTTCATTCCTTCAATCATGCCCTTCAAACTCATCCTATCCTTCAAAATGTTGCTTTCATGTCCCCTCCCCCTCCTCCTCCTCCTCCTCTCCTCTCGACCCACGATCATCCCTTCCCGACGTCTTCGTGGGAGATTGGTGAAGGGGATCATCAAAATCGACGGAAAGAAGAAGGGGATGATGATGATGATGATAACGACCACAATGGAAACGTCGTCGTTACTTATCGTGGCGGTGGTCCCAAAAATAATGATGCCCCCCGTCACACCAAGCTTTGTGCTAGAGGCCATTGGAGACCGGCTGAAGATACTAAGCTTAAAGAACTCGTCGCCCATTATGGCCCCCAGAATTGGAACTTGATCGCCGAAAATCTCCCTGGTAGATCAGGGAAAAGTTGTAGATTGAGATGGTTTAATCAATTAGATCCAAAGATAAACAGGAAGGCATTCAATGAAGAAGAAGAAGAGAGACTTTTAACAGCACACAGATTATATGGAAACAAATGGGCCATGATTGCTCGTTTGTTTCCTGGTAGAACTGATAATGCTGTCAAGAATCATTGGCACGTGATCATGGCTAGAAAACATAGACAACACTCCAATCTTTATCGAAGATCCACAAGAAAACCTCCTCCTCCTCCTGACGTAGATGAAAAGCTCGACACTAAGACCGTTCCAAAACACAACTTGTCGAGTGAATCCACCATCTCGAGCACGGCAGACGAGTTAGCCGCCTCCGCCTCCACCACCACTACCACTCATCTTTCTCTCTCCAACTCATCCTCTCTTTACTTCGGTCTCCAACTCACTCCAAGATGGAGTAGCGAGAAAGGAGCAACGGGGGCTGGCACGGGGAAGCTTTGGTATCGAGCGGATCAATCAGGGAACTCGGAGTCGAACTCGGAAGTTTCGGGGGCGGAGTCAGTGATTTCAACAAACCTAAGCTTAGCATCTGGGTGGGAAAATAGTAGAAATGGGAATGGGCAACATAATATGAAAATGCAGTTCATTGATTTCCTTGGAGTTGGAGCTTCATAA
Protein Sequence:
- >Cla017496|Citrullus_lanatus|MYB|Cla017496
MNLHSFNHALQTHPILQNVAFMSPPPPPPPPLLSTHDHPFPTSSWEIGEGDHQNRRKEEGDDDDDDNDHNGNVVVTYRGGGPKNNDAPRHTKLCARGHWRPAEDTKLKELVAHYGPQNWNLIAENLPGRSGKSCRLRWFNQLDPKINRKAFNEEEEERLLTAHRLYGNKWAMIARLFPGRTDNAVKNHWHVIMARKHRQHSNLYRRSTRKPPPPPDVDEKLDTKTVPKHNLSSESTISSTADELAASASTTTTTHLSLSNSSSLYFGLQLTPRWSSEKGATGAGTGKLWYRADQSGNSESNSEVSGAESVISTNLSLASGWENSRNGNGQHNMKMQFIDFLGVGAS