Information report for Ciclev10005102m
Gene Details
|
|
Functional Annotation
- Refseq: XP_006475333.1 — transcription factor MYB63
- Refseq: XP_024038620.1 — transcription factor MYB63
- TrEMBL: V4RMI1 — V4RMI1_9ROSI; Uncharacterized protein
- STRING: XP_006422238.1 — (Citrus clementina)
- GO:0009751 — Biological Process — response to salicylic acid
- GO:0009753 — Biological Process — response to jasmonic acid
- GO:0045893 — Biological Process — positive regulation of transcription, DNA-templated
- GO:2000652 — Biological Process — regulation of secondary cell wall biogenesis
- GO:0003677 — Molecular Function — DNA binding
Family Introduction
- MYB factors represent a family of proteins that include the conserved MYB DNA-binding domain.The first MYB gene identified was the ‘oncogene’ v-Myb derived from the avian myeloblastosis virus . Evidence obtained from sequence comparisons indicates that v-Myb may have originated from a vertebrate gene, which mutated once it became part of the virus. Many vertebrates contain three genes related to v-Myb c-Myb, A-Myb and B-Myb and other similar genes have been identified in insects, plants, fungi and slime moulds. The encoded proteins are crucial to the control of proliferation and differentiation in a number of cell types, and share the conserved MYB DNA-binding domain. This domain generally comprises up to three imperfect repeats, each forming a helix-turn-helix structure of about 53 amino acids. Three regularly spaced tryptophan residues, which form a tryptophan cluster in the three-dimensional helix-turn-helix structure, are characteristic of a MYB repeat. The three repeats in c-Myb are referred to as R1, R2 and R3; and repeats from other MYB proteins are categorised according to their similarity to either R1, R2 or R3.
- In contrast to animals, plants contain a MYB-protein subfamily that is characterised by the R2R3-type MYB domain. MYB proteins can be classified into three subfamilies depending on the number of adjacent repeats in the MYB domain (one, two or three). We refer to MYB-like proteins with one repeat as ‘MYB1R factors’, with two as ‘R2R3-type MYB’ factors, and with three repeats as ‘MYB3R’ factors.
Literature and News
Gene Resources
Homologs
- Cajanus cajan: C.cajan_36291
- Citrus sinensis: orange1.1g045411m
- Glycine max: Glyma.08G168100.1.p
- Gossypium arboreum: Cotton_A_35376_BGI-A2_v1.0
- Gossypium hirsutum: Gh_D01G0792, Gh_A01G0770, Gh_D08G2456, Gh_A08G2049
- Manihot esculenta: Manes.14G011000.1.p, Manes.06G175200.1.p
- Populus trichocarpa: Potri.007G067600.1, Potri.005G096600.2, Potri.005G096600.1
- Prunus mume: XP_008226183.1
- Prunus persica: Prupe.4G136300.1.p
- Ricinus communis: 30169.m006322
Sequences
CDS Sequence:
- >Ciclev10005102m|Citrus_clementina|MYB|Ciclev10005102m
ATGGTTGGGAGTCTGAAAATTTTCTTATTATCTCAAATGGGAAAAGGGAGAGCTCCATGTTGTGATAAGAGTCAAGTGAAGAGAGGGCCATGGAGTCCTGGTGAAGATTTAAGACTCATCACTTTTATTCAGAAACATGGTCATGAAAATTGGAGAGCGCTTCCTAAACAAGCTGGCCTTCTGCGATGTGGTAAGAGTTGCCGGCTGAGATGGATTAATTACCTGAGACCAGACGTGAAACGGGGGAACTTCACTCAAGAGGAAGAGGACACTATCATAAGGTTACATGAAAGCTTGGGAAACAGGTGGTCCAAAATTGCATCTCAGTTGCCTGGAAGAACAGATAATGAGATTAAAAATGTGTGGAACACACATTTGAAGAAAAGGTTGTCTTTCAGAGATGTTAAAAAAGATCAAGAATCTAAAGAATCTTCATCAATAAGCTCCCCTTCCTCCTCCTCATCCAGCACCATTATATCATCAGGCAAAAGAAGGGCAGATACTGAACTTGATGAGCACCAATGTGACCAAAACAATTACGTGCCCAAAAAGCCTCGTGAAGGACACGGTAGCATGACAGTATCGGAAAAATTAGTACAGCAGAGTTCAGAAACTGAAGAATCAAACCAAATCAACACGAGCAAGGGGGTGGTGATGACGACGAAGGAATTATTAGATTCGTCTTGCTCTTCGGATAACTCAGTTGTGTCAAATTCTAGCCAAGTTGATGCCACAAGGCCGAAAGACCAAATGGGTACATCACAATTTGGGTTTAGTGAACCTTATGATGTTGCCATAGGCTTAAACAATTTAGAAGAGGTGAATAAGCCTGAGATCATTTCAATTTCGGATACGGGGTTAGAGATTCCGTTGGAGTGCGATTTTGATTTCTGGAGCATGTTAGATAACTTGGGACCATTCCAATCACATGAAGTTGAAGCAAGCCAAAGCACAAGTTTTGGAGAAGCAAGTGACAACAGCAGAGAAGTTGACAGCCGAACATGGTTCCAATACTTAGAAAATGAGCTTGGATTAGAGGCAACAACAGAAGATGAAATTCAAAATTCAGCAAAAGTGGCAGCAGCTGCAACAGCTGACCCTATACCCCAGGAGACTTATGAGACTTTGCTGAAACCAGAAGTGGACCCCGGAGTCACTTATTTTCAACTGTGGAATGCTTCACTACAAAGTTCCGTTTGCGAGTGA
Protein Sequence:
- >Ciclev10005102m|Citrus_clementina|MYB|Ciclev10005102m
MVGSLKIFLLSQMGKGRAPCCDKSQVKRGPWSPGEDLRLITFIQKHGHENWRALPKQAGLLRCGKSCRLRWINYLRPDVKRGNFTQEEEDTIIRLHESLGNRWSKIASQLPGRTDNEIKNVWNTHLKKRLSFRDVKKDQESKESSSISSPSSSSSSTIISSGKRRADTELDEHQCDQNNYVPKKPREGHGSMTVSEKLVQQSSETEESNQINTSKGVVMTTKELLDSSCSSDNSVVSNSSQVDATRPKDQMGTSQFGFSEPYDVAIGLNNLEEVNKPEIISISDTGLEIPLECDFDFWSMLDNLGPFQSHEVEASQSTSFGEASDNSREVDSRTWFQYLENELGLEATTEDEIQNSAKVAAAATADPIPQETYETLLKPEVDPGVTYFQLWNASLQSSVCE*