Information report for Cc07_g06450
Gene Details
|
|
Functional Annotation
- Refseq: XP_027150688.1 — transcription factor MYB73-like
- Swissprot: O23160 — MYB73_ARATH; Transcription factor MYB73
- TrEMBL: A0A068U1X3 — A0A068U1X3_COFCA; Uncharacterized protein
- STRING: VIT_07s0129g01050.t01 — (Vitis vinifera)
- GO:0009723 — Biological Process — response to ethylene
- GO:0009737 — Biological Process — response to abscisic acid
- GO:0009751 — Biological Process — response to salicylic acid
- GO:0009753 — Biological Process — response to jasmonic acid
- GO:0010200 — Biological Process — response to chitin
- GO:0046686 — Biological Process — response to cadmium ion
- GO:0044212 — Molecular Function — transcription regulatory region DNA binding
Family Introduction
- MYB factors represent a family of proteins that include the conserved MYB DNA-binding domain.The first MYB gene identified was the ‘oncogene’ v-Myb derived from the avian myeloblastosis virus . Evidence obtained from sequence comparisons indicates that v-Myb may have originated from a vertebrate gene, which mutated once it became part of the virus. Many vertebrates contain three genes related to v-Myb c-Myb, A-Myb and B-Myb and other similar genes have been identified in insects, plants, fungi and slime moulds. The encoded proteins are crucial to the control of proliferation and differentiation in a number of cell types, and share the conserved MYB DNA-binding domain. This domain generally comprises up to three imperfect repeats, each forming a helix-turn-helix structure of about 53 amino acids. Three regularly spaced tryptophan residues, which form a tryptophan cluster in the three-dimensional helix-turn-helix structure, are characteristic of a MYB repeat. The three repeats in c-Myb are referred to as R1, R2 and R3; and repeats from other MYB proteins are categorised according to their similarity to either R1, R2 or R3.
- In contrast to animals, plants contain a MYB-protein subfamily that is characterised by the R2R3-type MYB domain. MYB proteins can be classified into three subfamilies depending on the number of adjacent repeats in the MYB domain (one, two or three). We refer to MYB-like proteins with one repeat as ‘MYB1R factors’, with two as ‘R2R3-type MYB’ factors, and with three repeats as ‘MYB3R’ factors.
Literature and News
Gene Resources
Homologs
- Capsicum annuum: CA02g14840
- Glycine max: Glyma.11G052100.1.p, Glyma.01G190100.1.p
- Manihot esculenta: Manes.12G108500.1.p
- Nicotiana benthamiana: Niben101Scf03188g06001.1
- Nicotiana tabacum: XP_016478014.1, XP_016442421.1
- Pyrus bretschneideri: Pbr015309.1
- Sesamum indicum: XP_011099313.1
- Solanum melongena: Sme2.5_24183.1_g00002.1, Sme2.5_00029.1_g00032.1
- Solanum tuberosum: PGSC0003DMP400043359
- Ziziphus jujuba: XP_015890262.1, XP_015865918.1
Sequences
CDS Sequence:
- >Cc07_g06450|Coffea_canephora|MYB|Cc07_g06450
ATGGCAAATATAAACAATAATATCAGTGCTAGTACTACTATTACCGTGAGAAAAGATGCTGATCGAATCAAAGGTCCGTGGAGTCCCGAAGAGGATGATCTCTTGCAACAACTGGTTCAAAAGCATGGACCTAGAAACTGGTCCTTGATTAGCAAGTCCATTCCGGGAAGATCCGGCAAGTCATGCCGCTTACGCTGGTGTAACCAGCTTTCTCCTCAAGTCGAGCACCGAGCCTTCACTCCCGAGGAAGATGACGCCATCATCCGGGCTCATGCCAAGTTCGGCAACAAATGGGCCACCATAGCCCGACTGCTCTCCGGTCGCACCGATAACGCCATCAAGAATCATTGGAATTCCACTCTCAAGAGAAAGTGCTCTTCCATCACTTCCTCCGACGAAGCTACCAACGACTTTCCACTCCACCACCACCACCAACCCTTGAAGAGAACCGCCAGCACTGGGTCCGGCGGACACGTCTCGGGTGGCTTGTCCTTGAACCCGGGCAGTCCGTCCGGCTCCGACGTCAGCTCTTCCAGCCTTCCCAATACCTCCTCTTCTCACGTATTTAAACCCGTTGCTAGGGCTGGCCCCGTTTTGCCTCCTCATCAGGTGGTGGAGACGACTTCGGAAAACATTACTGATCCTCCTACTTCTTTGAGCCTCTCCTTACCTGGAGTTGACTCCACCGAGGCGTCCACCCGCTCAACCGACTCAACTCAACCAAAGGTTCCGATTCAACTCCTTCCTCCTCCCCCGCCTCCATCACCACCAGCACCGGTTGACCAGCAGAACGGCCGTAAACAAATAGCTTTTGGGTCTCAGGTTCAGCCGCAGGATAAGGTATTTGTTCCTTTCACCGGGGAGTTGTTGGCGGTGATGCAAGAGATGATAAGGAACGAGGTGAGAAACTACATGATGGGAATGGAGCAGCAGCAGCAGAATCTTCCTCAACAGCATCAGCATCAGCAGCAGCAGCAGCAGATGATGATGATGCACGGCGGGATGGGGATGGGGATGTGCATGCAGCAGGCCTCTGTTGCTAATGAGGGGTTTAGGAATGCGGCCGTCAAGCGTGTTGGAATCAACAAGATCGATTGA
Protein Sequence:
- >Cc07_g06450|Coffea_canephora|MYB|Cc07_g06450
MANINNNISASTTITVRKDADRIKGPWSPEEDDLLQQLVQKHGPRNWSLISKSIPGRSGKSCRLRWCNQLSPQVEHRAFTPEEDDAIIRAHAKFGNKWATIARLLSGRTDNAIKNHWNSTLKRKCSSITSSDEATNDFPLHHHHQPLKRTASTGSGGHVSGGLSLNPGSPSGSDVSSSSLPNTSSSHVFKPVARAGPVLPPHQVVETTSENITDPPTSLSLSLPGVDSTEASTRSTDSTQPKVPIQLLPPPPPPSPPAPVDQQNGRKQIAFGSQVQPQDKVFVPFTGELLAVMQEMIRNEVRNYMMGMEQQQQNLPQQHQHQQQQQQMMMMHGGMGMGMCMQQASVANEGFRNAAVKRVGINKID*