Information report for CA09g05210
Gene Details
|
|
Functional Annotation
- Refseq: XP_016542418.1 — PREDICTED: myb-related protein B
- Refseq: XP_016542419.1 — PREDICTED: myb-related protein B
- Swissprot: Q6R032 — MB3R5_ARATH; Transcription factor MYB3R-5
- TrEMBL: A0A2G2YR20 — A0A2G2YR20_CAPAN; Uncharacterized protein
- STRING: PGSC0003DMT400023012 — (Solanum tuberosum)
- GO:0003677 — Molecular Function — DNA binding
Family Introduction
- MYB factors represent a family of proteins that include the conserved MYB DNA-binding domain.The first MYB gene identified was the ‘oncogene’ v-Myb derived from the avian myeloblastosis virus . Evidence obtained from sequence comparisons indicates that v-Myb may have originated from a vertebrate gene, which mutated once it became part of the virus. Many vertebrates contain three genes related to v-Myb c-Myb, A-Myb and B-Myb and other similar genes have been identified in insects, plants, fungi and slime moulds. The encoded proteins are crucial to the control of proliferation and differentiation in a number of cell types, and share the conserved MYB DNA-binding domain. This domain generally comprises up to three imperfect repeats, each forming a helix-turn-helix structure of about 53 amino acids. Three regularly spaced tryptophan residues, which form a tryptophan cluster in the three-dimensional helix-turn-helix structure, are characteristic of a MYB repeat. The three repeats in c-Myb are referred to as R1, R2 and R3; and repeats from other MYB proteins are categorised according to their similarity to either R1, R2 or R3.
- In contrast to animals, plants contain a MYB-protein subfamily that is characterised by the R2R3-type MYB domain. MYB proteins can be classified into three subfamilies depending on the number of adjacent repeats in the MYB domain (one, two or three). We refer to MYB-like proteins with one repeat as ‘MYB1R factors’, with two as ‘R2R3-type MYB’ factors, and with three repeats as ‘MYB3R’ factors.
Literature and News
Gene Resources
Homologs
- Nicotiana benthamiana: Niben101Scf05368g01010.1, Niben101Scf02466g01020.1, Niben101Scf14562g00013.1
- Nicotiana tabacum: XP_016501753.1, XP_016475731.1, XP_016475732.1, XP_016464214.1, XP_016464213.1, XP_016497879.1
- Petunia inflata: Peinf101Scf02677g00010.1, Peinf101Scf00301g04022.1
- Solanum lycopersicum: Solyc09g010820.2.1
- Solanum melongena: Sme2.5_00294.1_g00006.1
- Solanum tuberosum: PGSC0003DMP400015671
Sequences
CDS Sequence:
- >CA09g05210|Capsicum_annuum|MYB|CA09g05210
AAAACCACTGGTCCAATAAGGCGAGCAAGGGGTGGTTGGACACCTGAGGAGGATGATACTTTGAAAAAGGCTGTTTCAGTTTACAGAGGCAAATGTTGGAAGAAAATAGCTGAGTTGTTCCCGGATAGATCAGAAGTGCAATGTCTGCATCGCTGGCAGAAGGTTCTCAATCCAGAACTTGTTAAAGGACCCTGGACTCGGGAGGAGGATGATAAGATTATTGAACTGGTCGCTAAGTATGGGCCGATAAAATGGTCTGTCATAGCTAAATCATTGCCTGGTCGAATAGGGAAGCAATGTCGTGAGAGATGGCACAATCATTTGAATCCCAATATCAAAAAGGATGCTTGGACACTGGAAGAGGAACGGGCACTTATAGATGCTCATCGGATCCATGGTAACAAGTGGGCTGAAATTGCTAAAGTTCTGCCAGGAAGGGCTGATAATGGAATCAAGAATCATTGGAACAGCTCTCTGAGGAAGAAGTTAGACTTCTATTTAGCTACTGGAAACCTTCCATCTGTTAAATCTGAAGAGCTACTAGTTTGCTCAATTAAAACATCAGAAGCAGCTGACGTAGTTTCATCAGGAGCTATAGATATATGTAAAATAGAAAACGGATGGCAGGTGACAGAAATCAGTGCTTCCAATGGTGGTCCTCAAGCTGAATCCACTGATTCTGAAATCGTCAGGTTGGAAGCTCAATCACCAGAAGAAGATGCTATTCAACGCATCAAACAAAGTACAGAATCAGAAAACAGGTGTGATGGCTGGAACATAGATAGTGCAGTAGGTCGATTACAAGTTTTTGAAGCACCATTTCCTTGTGAAATCTCGACATGTGGTAGGTTATACTATGAACCACCAAGGTCAGAAAGTTGTATTCCACTGGATTCAGATCTTCTAAATATCGGCTGGGCACAATGTGAATCTGATGCAAGTCCAAGCCCGTCACCAAATGGTTTCTTCACTCCACCTAGTACAAAGGACCATAGCCTATATGCACAAACTCCTGAATCTGTACTTAGAATTGCTGCTAGAAGCTTCAATACGCCGTCCATATTAAGGAAAAGAAAGTCTCAAGGTAAACCTTCGACGCCAACTAATAAAATGAGGAAGTCAGATGGAGATTTCTGTAAGGACAAACTTATTGATGCGTGTGACAAAGTCCAATTCGACAGCTCAGACAAATCTAGCATGGATAATTGA
Protein Sequence:
- >CA09g05210|Capsicum_annuum|MYB|CA09g05210
KTTGPIRRARGGWTPEEDDTLKKAVSVYRGKCWKKIAELFPDRSEVQCLHRWQKVLNPELVKGPWTREEDDKIIELVAKYGPIKWSVIAKSLPGRIGKQCRERWHNHLNPNIKKDAWTLEEERALIDAHRIHGNKWAEIAKVLPGRADNGIKNHWNSSLRKKLDFYLATGNLPSVKSEELLVCSIKTSEAADVVSSGAIDICKIENGWQVTEISASNGGPQAESTDSEIVRLEAQSPEEDAIQRIKQSTESENRCDGWNIDSAVGRLQVFEAPFPCEISTCGRLYYEPPRSESCIPLDSDLLNIGWAQCESDASPSPSPNGFFTPPSTKDHSLYAQTPESVLRIAARSFNTPSILRKRKSQGKPSTPTNKMRKSDGDFCKDKLIDACDKVQFDSSDKSSMDN*