Information report for CA02g28060
Gene Details
|
|
Functional Annotation
- Refseq: XP_016561384.1 — PREDICTED: myb-related protein Hv1-like
- Swissprot: Q9LXF1 — MYB16_ARATH; Transcription factor MYB16
- TrEMBL: A0A1U8G084 — A0A1U8G084_CAPAN; Transcription factor MYB39
- TrEMBL: A0A2G2V9A2 — A0A2G2V9A2_CAPBA; Transcription factor MYB39
- TrEMBL: A0A2G3ACJ3 — A0A2G3ACJ3_CAPAN; myb-related protein Hv1-like
- STRING: PGSC0003DMT400003382 — (Solanum tuberosum)
- GO:0000902 — Biological Process — cell morphogenesis
- GO:0009651 — Biological Process — response to salt stress
- GO:0009723 — Biological Process — response to ethylene
- GO:0009733 — Biological Process — response to auxin
- GO:0009739 — Biological Process — response to gibberellin
- GO:0009751 — Biological Process — response to salicylic acid
- GO:0009753 — Biological Process — response to jasmonic acid
- GO:0046686 — Biological Process — response to cadmium ion
- GO:0003677 — Molecular Function — DNA binding
Family Introduction
- MYB factors represent a family of proteins that include the conserved MYB DNA-binding domain.The first MYB gene identified was the ‘oncogene’ v-Myb derived from the avian myeloblastosis virus . Evidence obtained from sequence comparisons indicates that v-Myb may have originated from a vertebrate gene, which mutated once it became part of the virus. Many vertebrates contain three genes related to v-Myb c-Myb, A-Myb and B-Myb and other similar genes have been identified in insects, plants, fungi and slime moulds. The encoded proteins are crucial to the control of proliferation and differentiation in a number of cell types, and share the conserved MYB DNA-binding domain. This domain generally comprises up to three imperfect repeats, each forming a helix-turn-helix structure of about 53 amino acids. Three regularly spaced tryptophan residues, which form a tryptophan cluster in the three-dimensional helix-turn-helix structure, are characteristic of a MYB repeat. The three repeats in c-Myb are referred to as R1, R2 and R3; and repeats from other MYB proteins are categorised according to their similarity to either R1, R2 or R3.
- In contrast to animals, plants contain a MYB-protein subfamily that is characterised by the R2R3-type MYB domain. MYB proteins can be classified into three subfamilies depending on the number of adjacent repeats in the MYB domain (one, two or three). We refer to MYB-like proteins with one repeat as ‘MYB1R factors’, with two as ‘R2R3-type MYB’ factors, and with three repeats as ‘MYB3R’ factors.
Literature and News
Gene Resources
Homologs
- Actinidia chinensis: Achn229071
- Citrullus lanatus: Cla010316
- Juglans regia: WALNUT_00019510-RA
- Manihot esculenta: Manes.01G093300.1.p, Manes.02G047900.1.p
- Nicotiana benthamiana: Niben101Scf04133g00001.1, Niben101Scf05060g09008.1
- Nicotiana tabacum: XP_016493290.1, XP_016479806.1
- Populus trichocarpa: Potri.017G086300.2, Potri.017G086300.1
- Sesamum indicum: XP_011098652.1
- Solanum lycopersicum: Solyc02g088190.2.1
- Solanum melongena: Sme2.5_00161.1_g00009.1
- Solanum tuberosum: PGSC0003DMP400002398
Sequences
CDS Sequence:
- >CA02g28060|Capsicum_annuum|MYB|CA02g28060
ATGGGTCGATCTCCATGCTGTGATAAAGTTGGGCTGAAAAAAGGACCTTGGACACCTGAAGAAGATCAAAAACTCTTAGCTTATATTGAAGAACATGGTCATGGTAGCTGGCGTGCATTACCTGCCAAAGCTGGACTTCAAAGATGTGGAAAGAGTTGTAGGCTCAGGTGGACTAATTACCTAAGGCCTGATATCAAGAGAGGAAAATTTACTTTACAAGAAGAACAAACCATCATTCAACTCCATGCTCTCTTAGGGAATAGGTGGTCGGCCATAGCCACTCATTTGCCCAAACGAACAGATAACGAGATCAAGAATTATTGGAATACGCATCTTAAGAAGCGGCTAGTGAAAATGGGCATTGACCCGGTGACCCACAAGCCCAAAAACGATGCACTGTTGTCCAATGACGGTCAGTCCAAGAACGCGGCTAACCTTAGCCACATGGCTCAGTGGGAAAGTGCTCGGCTCGAAGCTGAAGCTAGACTAGCTAGACAATCGAAGCTCAGGTCCAGTAGTTTCCATAGTTCAATCACTTCTCAAGAATTTACTGCTCCTTCACCTTCTAGTCCTCTTAGTAAACCGGTCGTGGGCCCAACACGTTGTCTAGACGTGCTGAAAGCCTGGAACGGTGTTTGGACCAAACCAATGAATGATGTTTCTGTCGCGAATGCTAGTGCTGGTATTTCAGTCACTGGCCTCGCAAGGGACTTGGAATCCCCTACTTCTACACTAGGCTATTTCGAAAATGCTCAACATATTTCCACATCAGGAATTGGAGGAAATTCAACTATTCTGTATGAATTTGTTGGCAATTCATCAGGGTCTAGTGAAGGTGGAATTATGAACAATGAAGAAAGTGAAGAAGATTGGAAGGGATTTGGAAACTCATCAACTGGACATTTGCCTGAATACAACAAAGATGGGATTAATGAAAATTCACTTTCATTCACATCAGGACTACAAGATTTGACCCTACCAATGGACACAACATGGACAGCAGAGTCTCTAAGGTCAAATACAGATCAAATTTCCCCTGCCAATTTTGTTGAGACATTTACTGATCTCTTGCTTAGCAATTCAGGCGATGGTGATTTGTCCGAAGGCGGTGGCACGGAGTCCGATAACGGAGGGGAAGGTAGTGGCAGCGGAAATGCTAGTGAGAACTGTGAAGATAACAAGAATTACTGGAATAGTATTTTTAACTTAGTCAATAATCCTTCCCCATCTGATTCAGCTATGTTCTGA
Protein Sequence:
- >CA02g28060|Capsicum_annuum|MYB|CA02g28060
MGRSPCCDKVGLKKGPWTPEEDQKLLAYIEEHGHGSWRALPAKAGLQRCGKSCRLRWTNYLRPDIKRGKFTLQEEQTIIQLHALLGNRWSAIATHLPKRTDNEIKNYWNTHLKKRLVKMGIDPVTHKPKNDALLSNDGQSKNAANLSHMAQWESARLEAEARLARQSKLRSSSFHSSITSQEFTAPSPSSPLSKPVVGPTRCLDVLKAWNGVWTKPMNDVSVANASAGISVTGLARDLESPTSTLGYFENAQHISTSGIGGNSTILYEFVGNSSGSSEGGIMNNEESEEDWKGFGNSSTGHLPEYNKDGINENSLSFTSGLQDLTLPMDTTWTAESLRSNTDQISPANFVETFTDLLLSNSGDGDLSEGGGTESDNGGEGSGSGNASENCEDNKNYWNSIFNLVNNPSPSDSAMF*