Information report for 462940321
Gene Details
Functional Annotation
- Refseq: XP_002445045.1 — transcription factor KUA1
- Swissprot: Q7XC57 — MYBS3_ORYSJ; Transcription factor MYBS3
- TrEMBL: C5YGT6 — C5YGT6_SORBI; Uncharacterized protein
- STRING: Sb07g003330.1 — (Sorghum bicolor)
- GO:0003677 — Molecular Function — DNA binding
Family Introduction
- MYB factors represent a family of proteins that include the conserved MYB DNA-binding domain.The first MYB gene identified was the ‘oncogene’ v-Myb derived from the avian myeloblastosis virus . Evidence obtained from sequence comparisons indicates that v-Myb may have originated from a vertebrate gene, which mutated once it became part of the virus. Many vertebrates contain three genes related to v-Myb c-Myb, A-Myb and B-Myb and other similar genes have been identified in insects, plants, fungi and slime moulds. The encoded proteins are crucial to the control of proliferation and differentiation in a number of cell types, and share the conserved MYB DNA-binding domain. This domain generally comprises up to three imperfect repeats, each forming a helix-turn-helix structure of about 53 amino acids. Three regularly spaced tryptophan residues, which form a tryptophan cluster in the three-dimensional helix-turn-helix structure, are characteristic of a MYB repeat. The three repeats in c-Myb are referred to as R1, R2 and R3; and repeats from other MYB proteins are categorised according to their similarity to either R1, R2 or R3.
- In contrast to animals, plants contain a MYB-protein subfamily that is characterised by the R2R3-type MYB domain. MYB proteins can be classified into three subfamilies depending on the number of adjacent repeats in the MYB domain (one, two or three). We refer to MYB-like proteins with one repeat as ‘MYB1R factors’, with two as ‘R2R3-type MYB’ factors, and with three repeats as ‘MYB3R’ factors.
Literature and News
Gene Resources
Homologs
- Brachypodium distachyon: Bradi3g17170.1.p
- Hordeum vulgare: MLOC_73122.2
- Panicum virgatum: Pavir.6NG055000.1.p, Pavir.6NG055000.2.p, Pavir.6NG055400.1.p, Pavir.6KG052200.3.p, Pavir.6KG052200.2.p, Pavir.6KG052200.1.p
- Setaria italica: Seita.6G063100.1.p, Seita.6G063100.2.p
- Setaria viridis: Sevir.6G060900.1.p, Sevir.6G060900.2.p
- Triticum aestivum: Traes_7BL_C184D0525.1, Traes_7AL_9E45828B0.1
- Zea mays: GRMZM2G108892_P01, GRMZM2G157306_P02
Sequences
CDS Sequence:
- >462940321|Eragrostis_tef|MYB|462940321
ATGGCGGCGAGGGAGGACGTGATGCGCAAGTGCAAGAGCATGGGCAACCTCGCCGCCGCCGCCGCCGCTCTAGACGGTGGCGGAGCCGGTGATGGGTATCTCTCTGATGGCGGCTTGATGCAGTCGCCCGGGAAGCGGCGGAGGGCGCAGGAGAGGAAGAAAGCTGTTCCTTGGACTGAAGAAGAGCACAGGACATTTCTTGCTGGTCTTGAAAAACTAGGAAAGGGAGACTGGAGGGGTATTGCGAAAAATTTTGTTACCACCAGAACACCAACTCAAGTAGCAAGTCATGCTCAGAAATATTTTCTCCGACAAACTAATCCAAACAAGAAGAAGCGCAGATCTAGTCTTTTTGATATGATGCCAAGCGATACGTCACAAGTGCCAAATTACCCTATATTACCAACTCCAATGGCAAAAGTGCATGATGTGGTAGCTATGACTAAACAACTGAGTTCTGTTCCTTGGACTGAAGAAGAGCACAGGACATTTCTTGCTGGTCTTGAAAAACTAGGAAAGGGAGACTGGAGGGGTATTGCGAAAAATTTTGTTACCACCAGAACACCAACTCAAGTAGCAAGTCATGCTCAGAAATATTTTCTCCGACAAACTAATCCAAACAAGAAGAAGCGCAGATCTAGTCTTTTTGATATGATGCCAAGCGATACGTCACAAGTGCCAAATTACCCTATATTACCAACTCCAATGGCAAAAGTGCATGATGTGGTAGCTATGACTAAACAACTGCAGAATAGCAAACTGGAAGCAGTCTCGTCTTCAAACTCAGCTAATGTATCATCTCAAGTTGGAATGAATCTACCCCCAATTCCATCCTTTAAGACGACAAAGATAGATTCAAACTTCAGCAAGATGAGCCCTATGGAGCGATGGAGAACTCCCTTTCCATTCAGGCCTGTTCCTAGAGCTTCCGAAGGGACTTCATCAATTGCCGCTACTGCCAATATAGCTGCTATGCCATCTCAAACTAACCTGACAGCATGCACAACCACATTCTTGAGCCCGAAAAGTGACCCGTCGTCACCACCTCTCCCAAAGGCAGATCATGCACCTACAGAAGAGAAGAAGGATTTAGAACTGACTGTTGGCCCACCCTCCCAACAAAACATGACCAATATCTCATCCTCGAATGCGGTCCAGCCAGAGGTAGACCAAATCATTAATGGGAAAAGTGACTGA
Protein Sequence:
- >462940321|Eragrostis_tef|MYB|462940321
MAAREDVMRKCKSMGNLAAAAAALDGGGAGDGYLSDGGLMQSPGKRRRAQERKKAVPWTEEEHRTFLAGLEKLGKGDWRGIAKNFVTTRTPTQVASHAQKYFLRQTNPNKKKRRSSLFDMMPSDTSQVPNYPILPTPMAKVHDVVAMTKQLSSVPWTEEEHRTFLAGLEKLGKGDWRGIAKNFVTTRTPTQVASHAQKYFLRQTNPNKKKRRSSLFDMMPSDTSQVPNYPILPTPMAKVHDVVAMTKQLQNSKLEAVSSSNSANVSSQVGMNLPPIPSFKTTKIDSNFSKMSPMERWRTPFPFRPVPRASEGTSSIAATANIAAMPSQTNLTACTTTFLSPKSDPSSPPLPKADHAPTEEKKDLELTVGPPSQQNMTNISSSNAVQPEVDQIINGKSD