Information report for 28603.m000172
Gene Details
|
|
Functional Annotation
- Refseq: XP_002533297.1 — transcription factor AS1
- Refseq: XP_025015577.1 — transcription factor AS1
- Swissprot: O80931 — AS1_ARATH; Transcription factor AS1
- TrEMBL: B9T4X8 — B9T4X8_RICCO; Asymmetric leaves1 and rough sheath, putative
- STRING: XP_002533297.1 — (Ricinus communis)
- GO:0008356 — Biological Process — asymmetric cell division
- GO:0009615 — Biological Process — response to virus
- GO:0009651 — Biological Process — response to salt stress
- GO:0009733 — Biological Process — response to auxin
- GO:0009739 — Biological Process — response to gibberellin
- GO:0009751 — Biological Process — response to salicylic acid
- GO:0009753 — Biological Process — response to jasmonic acid
- GO:0009944 — Biological Process — polarity specification of adaxial/abaxial axis
- GO:0010338 — Biological Process — leaf formation
- GO:0042742 — Biological Process — defense response to bacterium
- GO:0045088 — Biological Process — regulation of innate immune response
- GO:0045892 — Biological Process — negative regulation of transcription, DNA-templated
- GO:0046686 — Biological Process — response to cadmium ion
- GO:0050832 — Biological Process — defense response to fungus
- GO:0000793 — Cellular Component — condensed chromosome
- GO:0005730 — Cellular Component — nucleolus
- GO:0003677 — Molecular Function — DNA binding
- GO:0042803 — Molecular Function — protein homodimerization activity
Family Introduction
- MYB factors represent a family of proteins that include the conserved MYB DNA-binding domain.The first MYB gene identified was the ‘oncogene’ v-Myb derived from the avian myeloblastosis virus . Evidence obtained from sequence comparisons indicates that v-Myb may have originated from a vertebrate gene, which mutated once it became part of the virus. Many vertebrates contain three genes related to v-Myb c-Myb, A-Myb and B-Myb and other similar genes have been identified in insects, plants, fungi and slime moulds. The encoded proteins are crucial to the control of proliferation and differentiation in a number of cell types, and share the conserved MYB DNA-binding domain. This domain generally comprises up to three imperfect repeats, each forming a helix-turn-helix structure of about 53 amino acids. Three regularly spaced tryptophan residues, which form a tryptophan cluster in the three-dimensional helix-turn-helix structure, are characteristic of a MYB repeat. The three repeats in c-Myb are referred to as R1, R2 and R3; and repeats from other MYB proteins are categorised according to their similarity to either R1, R2 or R3.
- In contrast to animals, plants contain a MYB-protein subfamily that is characterised by the R2R3-type MYB domain. MYB proteins can be classified into three subfamilies depending on the number of adjacent repeats in the MYB domain (one, two or three). We refer to MYB-like proteins with one repeat as ‘MYB1R factors’, with two as ‘R2R3-type MYB’ factors, and with three repeats as ‘MYB3R’ factors.
Literature and News
Gene Resources
Homologs
- Manihot esculenta: Manes.09G092900.1.p, MANES_09G092900
- Populus trichocarpa: Potri.006G085900.1, POPTR_006G085900v3
- Prunus persica: Prupe.6G255800.4.p, Prupe.6G255800.3.p, Prupe.6G255800.2.p, Prupe.6G255800.1.p, PRUPE_6G255800
- Ziziphus jujuba: XP_015896997.1, XP_015896996.1, XP_015896995.1, XP_015896994.1, XP_015896993.1
Sequences
CDS Sequence:
- >28603.m000172|Ricinus_communis|MYB|28603.m000172
ATGAAGGAGAGGCAGCGTTGGAGAGCTGAAGAGGATGCTTTGTTACGTGCATACGTTAAACAATATGGTCCAAGGGAGTGGAATCTTGTGTCACAGCGCATGAACACACCCCTAAACAGGGATGCCAAATCCTGCTTAGAAAGGTGGAAGAACTACCTCAAGCCTGGTATAAAGAAAGGATCCCTTACTGAAGAAGAGCAGCGTCTTGTTATCCGACTTCAGGCCAAACACGGTAACAAATGGAAGAAAATTGCTGCTGAAGTTCCAGGTCGTACTGCAAAGAGACTTGGTAAGTGGTGGGAAGTGTTCAAAGAAAAGCAGCAGAGGGAGCAGAAGGAAAACAATAAGACGGTCGAACCAATTGAGGAGGGCAAGTACGACAGGATTCTTGAGACTTTTGCAGAAAAGCTAGTGAAAGAGCGCCCTGCTCCAGCATTTGTCATGGCTACTTCCAATGGGGGCTTTCTTCATACGGATCCACCTGCACCTGCACAAACTTCGCTTCCCCCATGGCTATCAACTTCTAGCAGCATATCTGCTGTCAGGCCACCCTCTCCATCTGTAACTCTAAGCCTCTCATCTTCGGCAGTTGCAGCACCACCTCCTATCCCTTGGTTGCAAACTGAGGGACTACTAGATAACACTCCTCTTGTTTTAAGCAGTTTGCCACCTCATGGATCAGTCCCTTCTTGCGGTGAGAATTTGGTGGTATCTGAGTTAGTGGATTGTTGCAGACAGTTGGAAGAAGGCTATCGTGCTTGGGCTGCACATAAGAAGGAAGCTGCCTGGAGGCTCAGAAGAGTACAATTGCAGCTGGAATCAGAGAAGTCCTGCCGGAAGAGGGAGAAAATGGAAGAGATAGAGTCGAAGATCAAGGCGCTTAGGGAAGAAGAGAAGGCTTCTCTTGATAGGATAGAAGCAGAATACAGGGAACAATTAGCAGAATTAAGAAGAGATGCAGAAGCCAAGGAGCAGAAACTGGCCGAGCAATGGGCATCAAAGCAGTTGCGTCTTTCCAAGTTTCTTGAACAGATTGGCGTGCAGGCCTAG
Protein Sequence:
- >28603.m000172|Ricinus_communis|MYB|28603.m000172
MKERQRWRAEEDALLRAYVKQYGPREWNLVSQRMNTPLNRDAKSCLERWKNYLKPGIKKGSLTEEEQRLVIRLQAKHGNKWKKIAAEVPGRTAKRLGKWWEVFKEKQQREQKENNKTVEPIEEGKYDRILETFAEKLVKERPAPAFVMATSNGGFLHTDPPAPAQTSLPPWLSTSSSISAVRPPSPSVTLSLSSSAVAAPPPIPWLQTEGLLDNTPLVLSSLPPHGSVPSCGENLVVSELVDCCRQLEEGYRAWAAHKKEAAWRLRRVQLQLESEKSCRKREKMEEIESKIKALREEEKASLDRIEAEYREQLAELRRDAEAKEQKLAEQWASKQLRLSKFLEQIGVQA