AT4G26150.1

Gene Details:

GO:0007623 — Biological Process — circadian rhythm
GO:0009416 — Biological Process — response to light stimulus
GO:0009735 — Biological Process — response to cytokinin
GO:0009740 — Biological Process — gibberellic acid mediated signaling pathway
GO:0009910 — Biological Process — negative regulation of flower development
GO:0010187 — Biological Process — negative regulation of seed germination
GO:0010380 — Biological Process — regulation of chlorophyll biosynthetic process
GO:0010468 — Biological Process — regulation of gene expression
GO:0030154 — Biological Process — cell differentiation
GO:0045944 — Biological Process — positive regulation of transcription from RNA polymerase II promoter
GO:0005634 — Cellular Component — nucleus
GO:0005667 — Cellular Component — transcription factor complex
GO:0000977 — Molecular Function — RNA polymerase II regulatory region sequence-specific DNA binding
GO:0001085 — Molecular Function — RNA polymerase II transcription factor binding
GO:0001228 — Molecular Function — transcriptional activator activity, RNA polymerase II transcription regulatory region sequence-specific binding
GO:0003682 — Molecular Function — chromatin binding
GO:0008270 — Molecular Function — zinc ion binding
GO:0044212 — Molecular Function — transcription regulatory region DNA binding

GATA factors were first identified as proteins that interact with conserved WGATAR (W = T or A; R = G or A) motifs involved in erythroid-specific gene expressionin vertebrates.
GATA factors are characterised by the presence of conserved, type-IV zinc-finger motifs Animal factors typically contain two C-x2-Cx17-C-x2-C zinc-finger domains. The majority of known fungal GATA factors contain a single C-x2-C-x17-C-x2-C finger with greatest similarity to the carboxyl (C) terminal finger of animal GATA factors.Several examples of fungal GATA factors containing a variant C-x2-C-x18-C-x2-C DNA-binding domain are also known.
Examples of both C-x2-C-x17-Cx2-C (Type IVa) and C-x2-C-x18-C-x2-C (Type IVb) GATA factors are found within fungi; animals onlycontain the former configuration, and plants only the latter. Plant GATA factors typically contain a single zinc finger. The Arabidopsis type-IV zinc-finger proteins may represent the previously defined family of nuclear GATA-binding proteins implicated in light-responsive transcription.

CDS Sequence:

>AT4G26150.1|Arabidopsis_thaliana|GATA|AT4G26150.1
ATGGGTTCCAATTTTCATTACACAATAGATCTCAATGAAGATCAAAACCATCAGCCTTTTTTCGCTTCTCTTGGATCCTCTCTTCATCATCATCTACAACAACAACAACAACAACAACAACATTTTCATCACCAAGCTTCTTCTAATCCCTCTTCTTTGATGTCACCGTCTCTTTCCTACTTTCCTTTCTTGATAAACTCTCGCCAAGATCAAGTATATGTTGGGTACAACAATAACACTTTTCATGATGTTCTTGATACCCATATCTCCCAACCTCTCGAGACCAAGAACTTTGTATCTGATGGTGGTTCATCATCAAGTGATCAAATGGTGCCCAAGAAGGAGACACGACTAAAATTGACGATAAAGAAGAAAGATAATCATCAAGACCAAACCGATCTTCCTCAATCCCCAATAAAAGACATGACAGGAACTAACTCGCTCAAGTGGATATCTTCGAAGGTGAGATTAATGAAGAAGAAAAAGGCGATTATTACCACCAGCGACAGCAGCAAACAACACACTAATAACGACCAATCCTCAAACCTAAGCAATTCGGAAAGACAGAATGGTTATAACAACGATTGCGTGATTAGGATTTGCTCCGATTGTAACACAACCAAGACTCCTCTTTGGAGAAGTGGTCCGAGAGGTCCCAAGTCTCTTTGTAACGCTTGTGGAATAAGGCAAAGGAAGGCCAGGCGGGCCGCTATGGCCACGGCAACCGCAACCGCAGTCTCTGGCGTATCCCCACCGGTCATGAAGAAGAAGATGCAAAACAAGAACAAGATATCAAATGGAGTTTATAAAATCTTATCTCCTTTGCCCCTAAAGGTAAACACGTGTAAGAGAATGATCACACTAGAGGAGACCGCATTAGCCGAGGATTTGGAGACCCAGAGCAACTCCACGATGTTATCATCTTCAGACAATATCTATTTCGATGATCTAGCATTACTGTTGAGCAAAAGTTCAGCTTATCAGCAAGTTTTCCCTCAAGATGAGAAGGAGGCTGCCATTTTACTAATGGCTCTATCGCACGGAATGGTTCACGGGTGA

Protein Sequence:

>AT4G26150.1|Arabidopsis_thaliana|GATA|AT4G26150.1
MGSNFHYTIDLNEDQNHQPFFASLGSSLHHHLQQQQQQQQHFHHQASSNPSSLMSPSLSYFPFLINSRQDQVYVGYNNNTFHDVLDTHISQPLETKNFVSDGGSSSSDQMVPKKETRLKLTIKKKDNHQDQTDLPQSPIKDMTGTNSLKWISSKVRLMKKKKAIITTSDSSKQHTNNDQSSNLSNSERQNGYNNDCVIRICSDCNTTKTPLWRSGPRGPKSLCNACGIRQRKARRAAMATATATAVSGVSPPVMKKKMQNKNKISNGVYKILSPLPLKVNTCKRMITLEETALAEDLETQSNSTMLSSSDNIYFDDLALLLSKSSAYQQVFPQDEKEAAILLMALSHGMVHG