Information report for SMil_00000233-RA_Salv
Gene Details
|
|
Functional Annotation
- Refseq: XP_011075851.1 — transcription factor TGA2.2
- Refseq: XP_011075852.1 — transcription factor TGA2.2
- Refseq: XP_011075853.1 — transcription factor TGA2.2
- Refseq: XP_011075855.1 — transcription factor TGA2.2
- Refseq: XP_011075856.1 — transcription factor TGA2.2
- Refseq: XP_011075857.1 — transcription factor TGA2.2
- Refseq: XP_020549248.1 — transcription factor TGA2.2
- Refseq: XP_020549249.1 — transcription factor TGA2.2
- Refseq: XP_020549250.1 — transcription factor TGA2.2
- Refseq: XP_020549251.1 — transcription factor TGA2.2
- Swissprot: Q41558 — HBP1C_WHEAT; Transcription factor HBP-1b(c1) (Fragment)
- TrEMBL: A0A068UNV8 — A0A068UNV8_COFCA; Uncharacterized protein
- STRING: Migut.F00128.1.p — (Erythranthe guttata)
- GO:0009410 — Biological Process — response to xenobiotic stimulus
- GO:0045892 — Biological Process — negative regulation of transcription, DNA-templated
- GO:0045893 — Biological Process — positive regulation of transcription, DNA-templated
- GO:0005634 — Cellular Component — nucleus
- GO:0005737 — Cellular Component — cytoplasm
- GO:0003700 — Molecular Function — transcription factor activity, sequence-specific DNA binding
- GO:0043565 — Molecular Function — sequence-specific DNA binding
Family Introduction
- The bZIP domain consists of two structural features located on a contiguous alpha-helix: first, a basic region of ~ 16 amino acid residues containing a nuclear localization signal followed by an invariant N-x7-R/K motif that contacts the DNA; and, second, a heptad repeat of leucines or other bulky hydrophobic amino acids positioned exactly nine amino acids towards the C-terminus, creating an amphipathic helix. To bind DNA, two subunits adhere via interactions between the hydrophobic sides of their helices, which creates a superimposing coiled-coil structure. The ability to form homo- and heterodimers is influenced by the electrostatic attraction and repulsion of polar residues flanking the hydrophobic interaction surface of the helices.
- Plant bZIP proteins preferentially bind to DNA sequences with an ACGT core. Binding specificity is regulated by flanking nucleotides. Plant bZIPs preferentially bind to the A-box (TACGTA), C-box (GACGTC) and G-box (CACGTG), but there are also examples of nonpalindromic binding sites.
Literature and News
Gene Resources
Homologs
- Artemisia annua: Aan005880
- Nicotiana benthamiana: Niben101Scf08716g00005.1
- Nicotiana tabacum: XP_016509560.1, XP_016452354.1, XP_016464277.1
- Sesamum indicum: XP_011075857.1, XP_011075856.1, XP_011075855.1, XP_011075854.1, XP_011075853.1, XP_011075852.1, XP_011075851.1, XP_011084590.1
- Solanum lycopersicum: Solyc11g064950.1.1
- Solanum tuberosum: PGSC0003DMP400016703, PGSC0003DMP400016702
Sequences
CDS Sequence:
- >SMil_00000233-RA_Salv|Salvia_miltiorrhiza|bZIP|SMil_00000233-RA_Salv
ATGGCAGATACCAGTCCTAGGACAGATACGTCTACTGATGCTGATACGGAAGATAAAATGTTTCAAAGCAATCAATTACAGGGAATAGGTGCTTCCGATGGCAGTGATAAGTCAAGAGATCAAAAGACTCTCCGTAGACTTGCTCAAAATCGTGAAGCTGCAAGGAAAAGCCGTTTGAGAAAAAAGGTAGGACTGCCACGTTTCCCATCTTTCAACGAAACTGCCGCCCATCCTATTCAGCTGTACTCTGGGTTCCCACCACCACCGATCTCTCATTGCCAGTTGCTGGCCTATGTTCAGCAGCTAGAAAGCAGCAGAATGAAATTGACACAACTTGAGCAAGAGCTTCAACGAGCTAGACAGCAGGGGATATTTATTTCAAGTTCAGGAGATCAATCTCAATCTATTGGTGGAAATGGTGCCTTGGCCTTTGATGTTGAGTATGCGAGGTGGCTGGAGGAGCATAACAAGCGGATTAACGAGCTTCGAGGCGCTGTCAATTCACATGCGGGTGATGGTGAACTCCGCATAATTGTTGACGGCATTGTGTCACATTATGATGACATCTTTAGGATTAAAGGTGATGCTGCAAAGGCCGACGTCTTTCACATCTTGTCAGGCATGTGGAAGACACCTGCTGAAAGATGCTTCCTCTGGCTTGGTGGTTTCCGTTCGTCTGAACTTCTTAAGCTACTAATTAATCAGTTAGAGCCATTGACTGAACAGCAGTTATTGGCCATCAACAACTTGCAACAATCGTCTCAACAAGCCGAAGATGCTCTATCTCAAGGAATGGAAGCATTGCAGCAGTCGTTGGCTGAGACATTAGCTGGTTCCCTCGGTCCAACGGGTTCATCTGGAAATGTTGCCAATTACATGGGGCAAATGGCGATGGCTATGGGGAAGTTAGGAACTCTCGAAGGCTTCATTCGTCAGGCGGATAACTTGCGGCAGCAAACCCTCCAACAAATGCACCGGATATTAACAACTCGCCAGTCAGCTCGCGCTCTCTTAGCTATCAGCGACTACTTCTCCCGTCTGCGGGCCCTGAGCTCTCTGTGGCTCGCCCGTCCGCGGGAATAA
Protein Sequence:
- >SMil_00000233-RA_Salv|Salvia_miltiorrhiza|bZIP|SMil_00000233-RA_Salv
MADTSPRTDTSTDADTEDKMFQSNQLQGIGASDGSDKSRDQKTLRRLAQNREAARKSRLRKKVGLPRFPSFNETAAHPIQLYSGFPPPPISHCQLLAYVQQLESSRMKLTQLEQELQRARQQGIFISSSGDQSQSIGGNGALAFDVEYARWLEEHNKRINELRGAVNSHAGDGELRIIVDGIVSHYDDIFRIKGDAAKADVFHILSGMWKTPAERCFLWLGGFRSSELLKLLINQLEPLTEQQLLAINNLQQSSQQAEDALSQGMEALQQSLAETLAGSLGPTGSSGNVANYMGQMAMAMGKLGTLEGFIRQADNLRQQTLQQMHRILTTRQSARALLAISDYFSRLRALSSLWLARPRE