Gene Details:

  • Gene ID: AT5G06950.1
  • Gene Name: AHBP-1B, BZIP20, HBP1B, MOJ9.12, TGA2
  • Gene Family: bZIP Family
  • Description: bZIP Family protein
  • Species: Arabidopsis thaliana
  • Source: bZIP family gene from PlantTFDB

Protein Features:

Annotation Proteins:

  • Refseq:  NP_001031845.1  — bZIP transcription factor family protein
  • Refseq:  NP_001078539.1  — bZIP transcription factor family protein
  • Refseq:  NP_001331392.1  — bZIP transcription factor family protein
  • Refseq:  NP_196312.1  — bZIP transcription factor family protein
  • Refseq:  NP_974744.1  — bZIP transcription factor family protein
  • Swissprot:  P43273  — TGA2_ARATH; Transcription factor TGA2
  • TrEMBL:  A0A384LQJ8  — A0A384LQJ8_ARATH; TGA2
  • TrEMBL:  B2BDR5  — B2BDR5_ARATH; BZIP transcription factor TGA2
  • STRING:  AT5G06950.1  — (Arabidopsis thaliana)

Gene Ontology:

  • GO:0009410  — Biological Process — response to xenobiotic stimulus
  • GO:0009626  — Biological Process — plant-type hypersensitive response
  • GO:0009862  — Biological Process — systemic acquired resistance, salicylic acid mediated signaling pathway
  • GO:0045892  — Biological Process — negative regulation of transcription, DNA-templated
  • GO:0045893  — Biological Process — positive regulation of transcription, DNA-templated
  • GO:0005634  — Cellular Component — nucleus
  • GO:0005737  — Cellular Component — cytoplasm
  • GO:0003677  — Molecular Function — DNA binding
  • GO:0003700  — Molecular Function — transcription factor activity, sequence-specific DNA binding
  • GO:0005515  — Molecular Function — protein binding
  • GO:0043565  — Molecular Function — sequence-specific DNA binding

Family Introduction:

  • The bZIP domain consists of two structural features located on a contiguous alpha-helix: first, a basic region of ~ 16 amino acid residues containing a nuclear localization signal followed by an invariant N-x7-R/K motif that contacts the DNA; and, second, a heptad repeat of leucines or other bulky hydrophobic amino acids positioned exactly nine amino acids towards the C-terminus, creating an amphipathic helix. To bind DNA, two subunits adhere via interactions between the hydrophobic sides of their helices, which creates a superimposing coiled-coil structure. The ability to form homo- and heterodimers is influenced by the electrostatic attraction and repulsion of polar residues flanking the hydrophobic interaction surface of the helices.
  • Plant bZIP proteins preferentially bind to DNA sequences with an ACGT core. Binding specificity is regulated by flanking nucleotides. Plant bZIPs preferentially bind to the A-box (TACGTA), C-box (GACGTC) and G-box (CACGTG), but there are also examples of nonpalindromic binding sites.

Literature:

Sequences:

CDS Sequence:
  • >AT5G06950.1|Arabidopsis_thaliana|bZIP|AT5G06950.1
    ATGGCTGATACCAGTCCGAGAACTGATGTCTCAACAGATGACGACACAGATCATCCTGATCTTGGGTCGGAGGGAGCACTAGTGAATACTGCTGCTTCTGATTCGAGTGACCGATCGAAGGGAAAGATGGATCAAAAGACTCTTCGTAGGCTTGCTCAAAACCGTGAGGCAGCAAGGAAAAGCAGATTGAGGAAGAAGGCTTATGTTCAGCAGCTAGAGAACAGCCGCTTGAAACTAACCCAGCTTGAGCAGGAGCTGCAAAGAGCAAGACAGCAGGGCGTCTTCATTTCAGGCACAGGAGACCAGGCCCATTCTACTGGTGGAAATGGTGCTTTGGCGTTTGATGCTGAACATTCACGGTGGTTGGAAGAAAAGAACAAGCAAATGAACGAGCTGAGGTCTGCTCTGAATGCGCATGCAGGTGATTCTGAGCTTCGAATAATAGTCGATGGTGTGATGGCTCACTATGAGGAGCTTTTCAGGATAAAGAGCAATGCAGCTAAGAATGATGTCTTTCACTTGCTATCTGGCATGTGGAAAACACCAGCTGAGAGATGTTTCTTGTGGCTCGGTGGATTTCGTTCATCCGAACTTCTAAAGCTTCTGGCGAATCAGTTGGAGCCAATGACAGAGAGACAGTTGATGGGCATAAATAACCTGCAACAGACATCGCAGCAGGCTGAAGATGCTTTGTCTCAAGGGATGGAGAGCTTACAACAGTCACTAGCTGATACTTTATCGAGCGGGACTCTTGGTTCAAGTTCATCAGGGAATGTCGCAAGCTACATGGGTCAGATGGCCATGGCAATGGGAAAGTTAGGTACACTCGAAGGATTTATCCGCCAGGCTGATAATTTGAGACTACAAACATTGCAACAGATGATAAGAGTATTAACAACGAGACAGTCAGCACGTGCTCTACTTGCAATACACGATTACTTCTCACGGCTACGAGCTCTAAGCTCCTTATGGCTTGCTCGACCCAGAGAGTGA
Protein Sequence:
  • >AT5G06950.1|Arabidopsis_thaliana|bZIP|AT5G06950.1
    MADTSPRTDVSTDDDTDHPDLGSEGALVNTAASDSSDRSKGKMDQKTLRRLAQNREAARKSRLRKKAYVQQLENSRLKLTQLEQELQRARQQGVFISGTGDQAHSTGGNGALAFDAEHSRWLEEKNKQMNELRSALNAHAGDSELRIIVDGVMAHYEELFRIKSNAAKNDVFHLLSGMWKTPAERCFLWLGGFRSSELLKLLANQLEPMTERQLMGINNLQQTSQQAEDALSQGMESLQQSLADTLSSGTLGSSSSGNVASYMGQMAMAMGKLGTLEGFIRQADNLRLQTLQQMIRVLTTRQSARALLAIHDYFSRLRALSSLWLARPRE