Gene Details:

  • Gene ID: AMDW01038896.1_FGP001
  • Gene Family: bZIP Family
  • Description: bZIP Family protein
  • Species: Oryza longistaminata
  • Source: bZIP family gene from PlantTFDB

Protein Features:

Annotation Proteins:

  • Refseq:  XP_015636710.1  — transcription factor TGAL6 isoform X1
  • Refseq:  XP_015636711.1  — transcription factor TGAL6 isoform X1
  • Refseq:  XP_015636712.1  — transcription factor TGAL6 isoform X1
  • Refseq:  XP_015636713.1  — transcription factor TGAL6 isoform X2
  • Refseq:  XP_015636714.1  — transcription factor TGAL6 isoform X2
  • Refseq:  XP_015636715.1  — transcription factor TGAL6 isoform X2
  • Refseq:  XP_025880677.1  — transcription factor TGAL6 isoform X1
  • Refseq:  XP_025880678.1  — transcription factor TGAL6 isoform X3
  • Swissprot:  A0A0P0WFC8  — TGAL6_ORYSJ; Transcription factor TGAL6
  • TrEMBL:  A0A0D3G046  — A0A0D3G046_9ORYZ; Uncharacterized protein
  • TrEMBL:  A0A0D3G049  — A0A0D3G049_9ORYZ; Uncharacterized protein
  • TrEMBL:  A0A0D9ZRD4  — A0A0D9ZRD4_9ORYZ; Uncharacterized protein
  • TrEMBL:  A0A0D9ZRD8  — A0A0D9ZRD8_9ORYZ; Uncharacterized protein
  • TrEMBL:  A0A0E0GKM9  — A0A0E0GKM9_ORYNI; Uncharacterized protein
  • TrEMBL:  A0A0E0PEM0  — A0A0E0PEM0_ORYRU; Uncharacterized protein
  • TrEMBL:  A0A0E0PEM4  — A0A0E0PEM4_ORYRU; Uncharacterized protein
  • TrEMBL:  A2XY14  — A2XY14_ORYSI; Uncharacterized protein
  • TrEMBL:  I1PPQ2  — I1PPQ2_ORYGL; Uncharacterized protein
  • STRING:  OGLUM04G26680.1  — (Oryza glumipatula)
  • STRING:  OS04T0637000-01  — (Oryza sativa)
  • STRING:  ONIVA03G13630.1  — (Oryza nivara)
  • STRING:  ORGLA04G0217100.1  — (Oryza glaberrima)
  • STRING:  OBART04G25140.2  — (Oryza barthii)

Gene Ontology:

  • GO:0006355  — Biological Process — regulation of transcription, DNA-templated
  • GO:0003700  — Molecular Function — transcription factor activity, sequence-specific DNA binding
  • GO:0043565  — Molecular Function — sequence-specific DNA binding

Family Introduction:

  • The bZIP domain consists of two structural features located on a contiguous alpha-helix: first, a basic region of ~ 16 amino acid residues containing a nuclear localization signal followed by an invariant N-x7-R/K motif that contacts the DNA; and, second, a heptad repeat of leucines or other bulky hydrophobic amino acids positioned exactly nine amino acids towards the C-terminus, creating an amphipathic helix. To bind DNA, two subunits adhere via interactions between the hydrophobic sides of their helices, which creates a superimposing coiled-coil structure. The ability to form homo- and heterodimers is influenced by the electrostatic attraction and repulsion of polar residues flanking the hydrophobic interaction surface of the helices.
  • Plant bZIP proteins preferentially bind to DNA sequences with an ACGT core. Binding specificity is regulated by flanking nucleotides. Plant bZIPs preferentially bind to the A-box (TACGTA), C-box (GACGTC) and G-box (CACGTG), but there are also examples of nonpalindromic binding sites.

Literature:

Sequences:

CDS Sequence:
  • >AMDW01038896.1_FGP001|Oryza_longistaminata|bZIP|AMDW01038896.1_FGP001
    GTCCTCAGAAGACTTGCACAAAACAGAGAGGCTGCACGGAAAAGCCGCCTGCGGAAAAAGGCTTACATCCAACAGCTGGAGACAAGCCGGTTGAAACTAGCGCAGTTAGAGCAAGAGCTTCAACGGGCCAGGCAGCAGGCTGTGTACGCAAATGGGAGCCTTCGAGAACCAAATCTTGGATTTACAGGACCGATCGATCCAGGTGCCTTAGGTTTTGAGATTAAGTACAGCCATTGGGTGGACGAGCAGAACCGTAACACGGGTGAGCTGAGGAATGCGCTGCTGCAGGGGCAGACGTCGGACCAGGACCTGGAGCTCAAGTTGCTCGTCGAGGCTGGGCTCGACAACTACAGCCGCCTCTTCGAGATGAAGGAGGAAGCCGCCAACTCCGACGTGTTCTACATCATGTCCGGCATGTGGAAGACCCCCACCGAGCGGTTCTTCCTGTGGATCGGCGGGTTCCGGCCATCGGAGGTTCTCAAG
Protein Sequence:
  • >AMDW01038896.1_FGP001|Oryza_longistaminata|bZIP|AMDW01038896.1_FGP001
    VLRRLAQNREAARKSRLRKKAYIQQLETSRLKLAQLEQELQRARQQAVYANGSLREPNLGFTGPIDPGALGFEIKYSHWVDEQNRNTGELRNALLQGQTSDQDLELKLLVEAGLDNYSRLFEMKEEAANSDVFYIMSGMWKTPTERFFLWIGGFRPSEVLK