Gene Details:
- Gene ID: EcC006800.20
- Gene Family: B3 Family
- Description: B3 Family protein
- Species: Eucalyptus camaldulensis
- Source: B3 family gene from PlantTFDB
Protein Features:
- PROSITE profile: PS50863
- SMART: SM01019
- SuperFamily: SSF101936
- Pfam: PF02362
- Gene3D: G3DSA:2.40.330.10
- InterPro: IPR003340 IPR015300
Annotation Proteins:
- Refseq: XP_018715725.1 — PREDICTED: B3 domain-containing transcription factor ABI3
- Swissprot: Q01593 — ABI3_ARATH; B3 domain-containing transcription factor ABI3
- TrEMBL: A0A067K3N4 — A0A067K3N4_JATCU; Uncharacterized protein
- TrEMBL: R4TV46 — R4TV46_POPTO; ABI3
- STRING: XP_010026024.1 — (Eucalyptus grandis)
Gene Ontology:
- GO:0006414 — Biological Process — translational elongation
- GO:0006468 — Biological Process — protein phosphorylation
- GO:0010082 — Biological Process — regulation of root meristem growth
- GO:0005840 — Cellular Component — ribosome
- GO:0003677 — Molecular Function — DNA binding
- GO:0003735 — Molecular Function — structural constituent of ribosome
- GO:0004672 — Molecular Function — protein kinase activity
- GO:0005515 — Molecular Function — protein binding
- GO:0005524 — Molecular Function — ATP binding
Family Introduction:
- The plant-specific B3 superfamily encompasses well-characterized families, such as the auxin response factor (ARF) family and the LAV family, as well as less well understood families, such as RAV and REM.
- All members of the B3 superfamily contain an ~ 110 amino acid region called the B3 domain. This domain was initially named because it was the third basic domain in the maize gene VIVIPAROUS1 (VP1).
- The first and second basic domains (B1 and B2) are specific to the VP1-like proteins, but genes that contain the B3 domain are widespread in plant genomes. The B3 domain of VP1 encodes a sequence-specific DNA binding activity.
Literature:
Sequences:
CDS Sequence:
- >EcC006800.20|Eucalyptus_camaldulensis|B3|EcC006800.20
GGTTGGAAGCCAGAGAACAATCTGAAGTTTCTTCTTCAGAAAGTGTTGAAACAGAGCGATGTGGGAAATCTAGGCAGGATTGTATTGCCAAAGAAAGAAGCCGAAACCCACCTGCCGGAGCTGGAGGCAAGGGACGGGATCTCCATAGCCATGGAAGACATTGGAACCTCCAAAGTCTGGAACATGCGTTACAGATTCTGGCCAAACAACAAAAGCAGGATGTATCTCCTCGAAAACACTGGAGATTTCGTGAGAGCAAATGGGCTCGAGGAAGGAGACTTCATAGTCATATATTCGGACGTCAAATGTGGCAAATACCTGATACGAGGAGTGAAGGTACGGCAACCCGAGGGGACGAAACCGGAGGCGCACAAGAGGCCCGAGAAGTCGCAGAGAAGCGCGCATGCGAGCTCTTCGCAGAAGAAGCAG
Protein Sequence:
- >EcC006800.20|Eucalyptus_camaldulensis|B3|EcC006800.20
GWKPENNLKFLLQKVLKQSDVGNLGRIVLPKKEAETHLPELEARDGISIAMEDIGTSKVWNMRYRFWPNNKSRMYLLENTGDFVRANGLEEGDFIVIYSDVKCGKYLIRGVKVRQPEGTKPEAHKRPEKSQRSAHASSSQKKQ