Gene Details:

  • Gene ID: Cotton_A_19408_BGI-A2_v1.0
  • Gene Name: F383_12243
  • Gene Family: B3 Family
  • Description: B3 Family protein
  • Species: Gossypium arboreum
  • Source: B3 family gene from PlantTFDB

Protein Features:

Annotation Proteins:

  • Refseq:  XP_012462596.1  — PREDICTED: B3 domain-containing protein REM19-like
  • Refseq:  XP_012462597.1  — PREDICTED: B3 domain-containing protein REM19-like
  • Refseq:  XP_016674964.1  — PREDICTED: B3 domain-containing protein REM19-like
  • Refseq:  XP_017619827.1  — PREDICTED: B3 domain-containing protein REM19-like
  • Swissprot:  Q8L3W1  — VRN1_ARATH; B3 domain-containing transcription factor VRN1
  • TrEMBL:  A0A0B0PYM7  — A0A0B0PYM7_GOSAR; B3 domain-containing transcription factor VRN1-like protein
  • TrEMBL:  A0A0D2W2K4  — A0A0D2W2K4_GOSRA; Uncharacterized protein
  • TrEMBL:  A0A1U8IGH7  — A0A1U8IGH7_GOSHI; B3 domain-containing protein REM19-like
  • STRING:  Gorai.013G039800.1  — (Gossypium raimondii)

Gene Ontology:

  • GO:0006355  — Biological Process — regulation of transcription, DNA-templated
  • GO:0005634  — Cellular Component — nucleus
  • GO:0003677  — Molecular Function — DNA binding

Family Introduction:

  • The plant-specific B3 superfamily encompasses well-characterized families, such as the auxin response factor (ARF) family and the LAV family, as well as less well understood families, such as RAV and REM.
  • All members of the B3 superfamily contain an ~ 110 amino acid region called the B3 domain. This domain was initially named because it was the third basic domain in the maize gene VIVIPAROUS1 (VP1).
  • The first and second basic domains (B1 and B2) are specific to the VP1-like proteins, but genes that contain the B3 domain are widespread in plant genomes. The B3 domain of VP1 encodes a sequence-specific DNA binding activity.

Literature:

Sequences:

CDS Sequence:
  • >Cotton_A_19408_BGI-A2_v1.0|Gossypium_arboreum|B3|Cotton_A_19408_BGI-A2_v1.0
    ATGTTTGGTGGCTCTAAACTTAGCAACTGCATAAACTGGGGTGGTGATGTCAATCGTCAAAATCCAAAGGCTGTGAATAATCAACCTATTCGAGGTTCAGGTGCTATGAAACCAGAACCAAAAAAGCGTGGGAGGAAGCGAAAGTTTGATCCTAATGTTCAGGATTCATCTGCTGGACGTGAAGATGATGCTGACATGCGCCTTAGATGTTATGAAAGTGCTTCTGCCCGAAAGAGAACCGTGACAGCTGAAGAAAGAGAGAGAGCAATTAATGCGGCCAAAGCATTTGAGCCTATTAACCCTTTCTGCAGGGTCGTCTTGCGACCATCATATCTATACAGGGGATGTATTATGTACTTACCATCGTGCTTTGCTGAGAAACATCTAAGTGGGGTTTCGGATTCCATTAAACTTCAGCTTCCTGATGGGAGACAGTGGTCTGTACGATGTCGTTATAAAGGAGGAAAGGCTAAGTTCAGTCGGGGATGGTATGAATTTACATTGGAGAATAATTTGGGAGAAGGGGATGTCTGTGTCTTTGAACTGCTCAGATCAAGGGAAATCGTGCTCAAAGTTACTGTATTTCGTGTAATGGAAAGCGGTGGACTAATGCACCGGTCTCAATGA
Protein Sequence:
  • >Cotton_A_19408_BGI-A2_v1.0|Gossypium_arboreum|B3|Cotton_A_19408_BGI-A2_v1.0
    MFGGSKLSNCINWGGDVNRQNPKAVNNQPIRGSGAMKPEPKKRGRKRKFDPNVQDSSAGREDDADMRLRCYESASARKRTVTAEERERAINAAKAFEPINPFCRVVLRPSYLYRGCIMYLPSCFAEKHLSGVSDSIKLQLPDGRQWSVRCRYKGGKAKFSRGWYEFTLENNLGEGDVCVFELLRSREIVLKVTVFRVMESGGLMHRSQ