Information report for Thecc1EG004742t1
Gene Details
|
|
Functional Annotation
- Refseq: XP_017973701.1 — PREDICTED: two-component response regulator ARR1
- Swissprot: Q9ZWJ9 — ARR2_ARATH; Two-component response regulator ARR2
- TrEMBL: A0A061DR87 — A0A061DR87_THECC; Response regulator 2, putative
- STRING: EOX95190 — (Theobroma cacao)
- GO:0000160 — Biological Process — phosphorelay signal transduction system
- GO:0006355 — Biological Process — regulation of transcription, DNA-templated
- GO:0005634 — Cellular Component — nucleus
- GO:0003677 — Molecular Function — DNA binding
Family Introduction
- The Arabidopsis genome codes for 22 response regulators (ARRs), 12 of which contain a Myb-like DNA binding domain called ARRM (type B). The remainder (type A) possess no apparent functional unit other than a signal receiver domain containing two aspartate and one lysine residues (DDK) at invariant positions, and their genes are transcriptionally induced by cytokinins without de novo protein synthesis. The type B members, ARR1 and ARR2, bind DNA in a sequence-specific manner and work as transcriptional activators.
- Here we present evidence that ARR1 mediates a cytokinin signal, probably through its NH2-terminal signal receiver domain, and transactivates ARR6, which is immediately responsive to cytokinins. A paralogous response regulator, ARR2, shows almost identical characteristics to ARR1, suggesting a functional overlap. Residual cytokinin responses observed with the arr1-1 mutant may have been provided by ARR2. In addition to ARR6, other type A member genes, including ARR4, ARR5, ARR7, ARR8, and ARR9, were also activated by DEX at various levels in 35S::ARR1DDK::GR plants, suggesting that all the immediate cytokinin-responsive genes belonging to this group are directly activated by ARR1. Also, other cytokinin-responsive genes whose promoter regions contain the ARR1 recognition sequences are possibly transactivated by ARR1. A screening for ARR1 target genes using transgenic 35S::ARR1-DDK::GR plants will shed light on the whole view of the early cytokinin signal transduction pathway. We conclude that ARR1 is a principal transcription factor-type response regulator that is involved in an early step of cytokinin signal transduction, possibly as a partner of the sensor histidine kinase CRE1.
Literature and News
Gene Resources
Homologs
- Actinidia chinensis: Achn103181
- Arachis hypogaea: Ahy012644
- Cajanus cajan: C.cajan_04108
- Citrullus lanatus: Cla021770, Cla009269
- Cucumis melo: MELO3C006693P1, MELO3C021290P1
- Cucumis sativus: Cucsa.069440.2, Cucsa.069440.1, Cucsa.252760.1
- Gossypium arboreum: Cotton_A_26239_BGI-A2_v1.0, Cotton_A_26439_BGI-A2_v1.0
- Gossypium hirsutum: Gh_A07G1154, Gh_D07G1252, Gh_D11G1176, Gh_A11G1020
- Manihot esculenta: Manes.15G007400.1.p
- Populus trichocarpa: Potri.010G001000.5
- Ricinus communis: 29986.m001672, 29889.m003245
- Vitis vinifera: GSVIVT01028069001
Sequences
CDS Sequence:
- >Thecc1EG004742t1|Theobroma_cacao|ARR-B|Thecc1EG004742t1
ATGGATGAACAGAATATTCAAATATCCCTTTTGAAGAACGGTTGTGCAGATAAAGTTAACAACAGTGTTGTTGGTGAATTTCCGGCTGGTTTGAAGATTCTCATAGTTGATGATTCTAGAACATGTCTCCTAGTATTAGAGATAATGCTTCGAAAGCTTTTATATGAAGTTACCACGTGTCGGCTAGCGAAGGACGCCCTTGCTTTGCTTCGAGAAGACAATGAAAGATTTGATATCGTCATATGCGATTTACATATGCCTGAAATGGATGGACTTAAGCTTCTTGATATCATAGGATTAGAAATGGACTTGCCGGTTGTTATGATGTCTGCAGATGATAAAAGAGGAGTTATTATGAAGGGTATAATCCATGGAGCTTGTGATTATTTGGTAAAACCAGTTCGCTTAGACTCGATTAGATTCATATGGCAGCATGTGGTTCGTAGGAAAAGACGTAGCTTGGGAGAGTTTCAGCAGCCAGGGAACAATGTCAATGACAGGTTATTGAAATTAGAACAAGCTAAGCATGCTGATCAAATGCCCGCGAGAGATAAAGGAAGCCTGCAAAGCTTGAAACGGACAAGGGAAGATGAAGATGAAGATGAAGATGATGGTGAATTCTCTGATGAAGTGACAACTACGAAGAAGCCGAGGATGATTTGGACCCAAGAGCTCCATGATATGTTTGTTGCTGCTGTAAATCAACTAGGACGTGACAAGGCTGTTCCTAAGAAAATTTTGGAGCGGATGCAAGCCATGAATGTTACTGGTCTTACAAGAGCAAATATTGCCAGTCATCTTCAGGTAACGTTCTATTTTCATGAAATTCCTTTAACAGGTTCTGGATTATTCCAGAATTAA
Protein Sequence:
- >Thecc1EG004742t1|Theobroma_cacao|ARR-B|Thecc1EG004742t1
MDEQNIQISLLKNGCADKVNNSVVGEFPAGLKILIVDDSRTCLLVLEIMLRKLLYEVTTCRLAKDALALLREDNERFDIVICDLHMPEMDGLKLLDIIGLEMDLPVVMMSADDKRGVIMKGIIHGACDYLVKPVRLDSIRFIWQHVVRRKRRSLGEFQQPGNNVNDRLLKLEQAKHADQMPARDKGSLQSLKRTREDEDEDEDDGEFSDEVTTTKKPRMIWTQELHDMFVAAVNQLGRDKAVPKKILERMQAMNVTGLTRANIASHLQVTFYFHEIPLTGSGLFQN*