Information report for PSME_00041093-RA
Gene Details
|
|
Functional Annotation
- Refseq: XP_015572552.1 — two-component response regulator ARR12 isoform X1
- Refseq: XP_025012481.1 — two-component response regulator ARR12 isoform X2
- Swissprot: O49397 — ARR10_ARATH; Two-component response regulator ARR10
- TrEMBL: A0A2P5XZ53 — A0A2P5XZ53_GOSBA; Two-component response regulator
- TrEMBL: A0A445K107 — A0A445K107_GLYSO; Two-component response regulator
- STRING: XP_002515447.1 — (Ricinus communis)
- GO:0000160 — Biological Process — phosphorelay signal transduction system
- GO:0003677 — Molecular Function — DNA binding
Family Introduction
- The Arabidopsis genome codes for 22 response regulators (ARRs), 12 of which contain a Myb-like DNA binding domain called ARRM (type B). The remainder (type A) possess no apparent functional unit other than a signal receiver domain containing two aspartate and one lysine residues (DDK) at invariant positions, and their genes are transcriptionally induced by cytokinins without de novo protein synthesis. The type B members, ARR1 and ARR2, bind DNA in a sequence-specific manner and work as transcriptional activators.
- Here we present evidence that ARR1 mediates a cytokinin signal, probably through its NH2-terminal signal receiver domain, and transactivates ARR6, which is immediately responsive to cytokinins. A paralogous response regulator, ARR2, shows almost identical characteristics to ARR1, suggesting a functional overlap. Residual cytokinin responses observed with the arr1-1 mutant may have been provided by ARR2. In addition to ARR6, other type A member genes, including ARR4, ARR5, ARR7, ARR8, and ARR9, were also activated by DEX at various levels in 35S::ARR1DDK::GR plants, suggesting that all the immediate cytokinin-responsive genes belonging to this group are directly activated by ARR1. Also, other cytokinin-responsive genes whose promoter regions contain the ARR1 recognition sequences are possibly transactivated by ARR1. A screening for ARR1 target genes using transgenic 35S::ARR1-DDK::GR plants will shed light on the whole view of the early cytokinin signal transduction pathway. We conclude that ARR1 is a principal transcription factor-type response regulator that is involved in an early step of cytokinin signal transduction, possibly as a partner of the sensor histidine kinase CRE1.
Literature and News
Gene Resources
Homologs
- Actinidia chinensis: Achn103181, Achn163021
- Cajanus cajan: C.cajan_29495
- Cicer arietinum: XP_004508173.1, XP_004508172.1
- Citrullus lanatus: Cla021011
- Cucumis sativus: Cucsa.271670.1
- Fragaria vesca: mrna05178.1-v1.0-hybrid
- Gossypium arboreum: Cotton_A_09096_BGI-A2_v1.0
- Gossypium hirsutum: Gh_D13G1951
- Malus domestica: MDP0000224740, MDP0000290818
- Medicago truncatula: Medtr4g121020.3, Medtr4g121020.1
- Prunus mume: XP_008223286.1, XP_008223287.1
- Prunus persica: Prupe.1G126400.1.p, Prupe.1G126400.2.p
- Pyrus bretschneideri: Pbr011993.1
- Ricinus communis: 29848.m004559
- Solanum tuberosum: PGSC0003DMP400040747
- Vitis vinifera: GSVIVT01003721001
Sequences
CDS Sequence:
- >PSME_00041093-RA|Pseudotsuga_menziesii|ARR-B|PSME_00041093-RA
ATGCGAGTGGCTGAGATTTATGAGATTTATAGGGTCAAAGTGATGAACAATGAGGAGGCTAATGATGATTTTCCTATCTATATGCGTGTCCTGGTTGTGGATGATGATCCAATTTGCCTTCTGCTACTGGAGAATTTTCTTCGTCGCTGCCAGTATAACTTTACATCATGTGGGCAAGCAATCACAGCCCTGAGCCTGTTAAGGGAGAATAGAGACAAATTTGACCTTGTGATAATTGATGTCTATATGCCTGACATGGATGGATTTAAGCTACTGGAACTTGTGGGGCTGGAATTGGACCTTCATGTTATCATGATGTCAGCAAATGGTGAAACAAGTGCTGTGATGAAGGGGATAACTCACGGGGCTTGTGACTACCTGCTGAAGCCTGATGATGATGAGGATGAACATGATATTGAAGATCCTTCAACATCAAAAAAGCCAAGAGTTGTTTGGTCAGTGGAGTTACATCAACAATTTGTCAATGCTGTTAATACATTGGGAATAGACACTATTCCAAAGTGGATATTGGAGCTTATGAATGTTCAAGGATTGACACAAGAAAATGTTGCAAGCCATCTGCAGAAGTATAGACTATACTTGAAAAGGCTCAGTGGTGTGGCGAGTCAACATGGTAGCATGGGAAATGCATTTGGAGGAGGGAGGGAATCTTCGTTTGGTTCTCTTTACCAAGTAGATGGAATTGGTGATTTGCAAGTTCTTGCTCAATCTGTTCAACTGTCTGCTCGTGCTCTTGAATCATTGCAAGTAGGAGTTCTGGGTATATTAAATGGTTCAGTAGGCTTGGGTTTATTAGGTCTGAATTCCTCTGGAATTCTCCAATTTGACTCTCTTCTAGGGCTAAGCTGTAATAACAGCATTGGAAGAGCACAAGGAATTGCACCTGTTAACAATCCAATGAATGCATTTCCTTGTTTATCAACTGGACTTGAACTAGATTAG
Protein Sequence:
- >PSME_00041093-RA|Pseudotsuga_menziesii|ARR-B|PSME_00041093-RA
MRVAEIYEIYRVKVMNNEEANDDFPIYMRVLVVDDDPICLLLLENFLRRCQYNFTSCGQAITALSLLRENRDKFDLVIIDVYMPDMDGFKLLELVGLELDLHVIMMSANGETSAVMKGITHGACDYLLKPDDDEDEHDIEDPSTSKKPRVVWSVELHQQFVNAVNTLGIDTIPKWILELMNVQGLTQENVASHLQKYRLYLKRLSGVASQHGSMGNAFGGGRESSFGSLYQVDGIGDLQVLAQSVQLSARALESLQVGVLGILNGSVGLGLLGLNSSGILQFDSLLGLSCNNSIGRAQGIAPVNNPMNAFPCLSTGLELD