Information report for DCAR_022080
Gene Details
|
|
Functional Annotation
- Refseq: XP_017256488.1 — PREDICTED: two-component response regulator ORR24-like
- TrEMBL: A0A164VM15 — A0A164VM15_DAUCS; Uncharacterized protein
- GO:0000160 — Biological Process — phosphorelay signal transduction system
- GO:0003677 — Molecular Function — DNA binding
Family Introduction
- The Arabidopsis genome codes for 22 response regulators (ARRs), 12 of which contain a Myb-like DNA binding domain called ARRM (type B). The remainder (type A) possess no apparent functional unit other than a signal receiver domain containing two aspartate and one lysine residues (DDK) at invariant positions, and their genes are transcriptionally induced by cytokinins without de novo protein synthesis. The type B members, ARR1 and ARR2, bind DNA in a sequence-specific manner and work as transcriptional activators.
- Here we present evidence that ARR1 mediates a cytokinin signal, probably through its NH2-terminal signal receiver domain, and transactivates ARR6, which is immediately responsive to cytokinins. A paralogous response regulator, ARR2, shows almost identical characteristics to ARR1, suggesting a functional overlap. Residual cytokinin responses observed with the arr1-1 mutant may have been provided by ARR2. In addition to ARR6, other type A member genes, including ARR4, ARR5, ARR7, ARR8, and ARR9, were also activated by DEX at various levels in 35S::ARR1DDK::GR plants, suggesting that all the immediate cytokinin-responsive genes belonging to this group are directly activated by ARR1. Also, other cytokinin-responsive genes whose promoter regions contain the ARR1 recognition sequences are possibly transactivated by ARR1. A screening for ARR1 target genes using transgenic 35S::ARR1-DDK::GR plants will shed light on the whole view of the early cytokinin signal transduction pathway. We conclude that ARR1 is a principal transcription factor-type response regulator that is involved in an early step of cytokinin signal transduction, possibly as a partner of the sensor histidine kinase CRE1.
Literature and News
Gene Resources
Homologs
- Brassica napus: GSBRNA2T00123894001
- Citrus sinensis: orange1.1g040406m
- Medicago truncatula: Medtr3g102600.3, Medtr3g102600.1
- Nicotiana benthamiana: Niben101Scf03245g07014.1
- Nicotiana tabacum: XP_016455294.1, XP_016465560.1, XP_016465559.1, XP_016465558.1, XP_016465557.1
- Salvia miltiorrhiza: SMil_00026235-RA_Salv
- Solanum melongena: Sme2.5_07146.1_g00002.1
- Ziziphus jujuba: XP_015878004.1
Sequences
CDS Sequence:
- >DCAR_022080|Daucus_carota|ARR-B|DCAR_022080
ATGGACGTTCACTTGCCAAACATGGATGGTCTTCAACTTCTAAAATGCATTAATAAAGATTATGATATACCTGTAATATTAACAACAGATGATGTCATGCACGAGCTAATTGGAGATGGACTTAACAATGGGGCCGAATCTTGCTTGCTAAAGCCTATATTGCCTGATGCTGTCAGGGACATATGGCAATTCTATGAATTGAGGAAAGTAAACAAGAACATACATACTATGTCCGGAAGCTCTTTAGCAAAGGTACCATCAAGCATTGGCCCATCTACAACTGATAATTCTAATGACAAACCAGCGAAAGCTATTCCAAACACTATATTGGAAAAGATGAATGAGCCTGGAGTCTCTCGAGAACAAGTGGCTAGTCATTTGCAGAAATATCGAAAATTCTTGAATGGAGTTTTGGATGGCAAGATTAGTCTTCAATCTTCAAAATACTGCTCCAATTTGAATTATAATCACTCGAGTATAGTGGATGGGAATCCAAACCTATTTTTGATCAATCAACTAAGAAATGAGCAAAGATCTAGCAAGGACGCAGCCCCAATTCGTGCATCCTTACCCATGTTGAGATTCAACGAAGCTGGGTCTTCTTCCAGGTTGATAATGAATGCAATGTCAGCACCAAACTATGCACCTTGTGCTGATATAAATATAAAAGCAGATTGGCTTAGTAATGGGATTGCTACTTCTGAAAATGATGGTAACTTAAACATTGGGAATATCGTTGAAAGCAACCATGCCTATTATAATCGCTACGAGGAAGGTGAGAAGGGTGATTATAATCAAACTACACTGACGCCACATCAAAACAATAAATTTTCTGATGGTGGATTGCTTGGAGGTGCTAACATCAATGATTGGCTTCATGCAACAAATCTTACTGTACTTTCTGATAGTGTTATTGAATCCATTCATAATGCCTTCATTTCTCAACCACCGCTAAATCCTGAAGCACAAGGCAACACTAGAATCTTTAATCGAAACAATTTCAACAGAGTTCAGACGAGATACATGCAACCCACGCATTCTGGCATTGGTGCTTCATTGGTTGCAAATCAAGATGAATATACCTTCCCGGTGAATAAAAAGCCGCGAAATGGTGATGATGATTGTAATGAATTGAATAATTTTGACTTGCTTAGTTTCGATCCGGACTCAAGTAAGATTGTCCAAAATCCTTTTCATGTTTTATCTAGAAAGCTAGTTAGAAGAAAGGAAAAGAGGAAACACTTTCTAGGAAATCTTGAAAATTCATATCAAGGAATCTAG
Protein Sequence:
- >DCAR_022080|Daucus_carota|ARR-B|DCAR_022080
MDVHLPNMDGLQLLKCINKDYDIPVILTTDDVMHELIGDGLNNGAESCLLKPILPDAVRDIWQFYELRKVNKNIHTMSGSSLAKVPSSIGPSTTDNSNDKPAKAIPNTILEKMNEPGVSREQVASHLQKYRKFLNGVLDGKISLQSSKYCSNLNYNHSSIVDGNPNLFLINQLRNEQRSSKDAAPIRASLPMLRFNEAGSSSRLIMNAMSAPNYAPCADINIKADWLSNGIATSENDGNLNIGNIVESNHAYYNRYEEGEKGDYNQTTLTPHQNNKFSDGGLLGGANINDWLHATNLTVLSDSVIESIHNAFISQPPLNPEAQGNTRIFNRNNFNRVQTRYMQPTHSGIGASLVANQDEYTFPVNKKPRNGDDDCNELNNFDLLSFDPDSSKIVQNPFHVLSRKLVRRKEKRKHFLGNLENSYQGI*