Gene Details:

  • Gene ID: A4A49_02428
  • Suggest Gene Name: REPRESSOR OF GA1-3 1
  • Description: putative flowering gene
  • Species: Nicotiana attenuata
  • Source: Putative flowering gene from PlantCFG

Protein Features:

Functional Descriptions:

  • Member of the VHIID/DELLA regulatory family. Contains homopolymeric serine and threonine residues, a putative nuclear localization signal, leucine heptad repeats, and an LXXLL motif. Putative transcriptional regulator repressing the gibberellin response and integration of phytohormone signalling. DELLAs repress cell proliferation and expansion that drives plant growth. The protein undergoes degradation in response to GA via the 26S proteasome. RGA1 binds to PIF3 and inhibits its DNA binding activity and thus affects the expression of PIF3 regulated genes. RGA may be involved in reducing ROS accumulation in response to stress by up-regulating the transcription of superoxide dismutases. Represses GA-induced vegetative growth and floral initiation. Rapidly degraded in response to GA. Involved in fruit and flower development.

Homologous

Sequences:

CDS Sequence
  • >A4A49_02428
    ATGAGTTATAGATCAGAGATGTCTATGGACACAACCACGGAAGATGGGGAATCCTTTATTTCTAATACAGATGCAATCATCAACGGCACTTCTGATATTTCAGCGTTGGCTGAGAGCTTAATCTCAGGTCCCAACATCCCTAATTCGTCTTGGACGAGTGCAGACGACATCCAGCAGCAAATTTCGACGGCTGGTGGTGGTGCTGATGATGATATGATGATTGTATCATCAGGTGCATCTTCCATGTTATCCAATACTAATAAGCAAAGTGAGATTATGATATTTAATGTTGATTTCAGGGCGTTTGCTGTTTGCAATAACAGTGATAAAATTGAGGAGAAAGGATCAGCTGAGAGCAGCAAGCGATTGGAATCTCGCTTTGGTTTAGGTTCGAATATTGGTGGGGCAGTGAATGAAGAAACCAGCTTTAGGTTTGTCAATATATATACATTGATGGCTTGTGCCGAGGCAATCCAACAGAACAACTTAAATCTAGCTGATGCACTCGTCAGCGACATAAAAAGACTTGCGGTTCAACAATCTGGAGCCGTGAAAAAGGTGGTGTATTATTTTGAAGACACTTTGGATCGAACTATTAACGGAATGAATGCACCGTATATTGTTGAATCCTCCTGA
Protein Sequence
  • >A4A49_02428
    MSYRSEMSMDTTTEDGESFISNTDAIINGTSDISALAESLISGPNIPNSSWTSADDIQQQISTAGGGADDDMMIVSSGASSMLSNTNKQSEIMIFNVDFRAFAVCNNSDKIEEKGSAESSKRLESRFGLGSNIGGAVNEETSFRFVNIYTLMACAEAIQQNNLNLADALVSDIKRLAVQQSGAVKKVVYYFEDTLDRTINGMNAPYIVESS