OsPID;OsPINOID

Gene Details

MSU gene ID: LOC_Os12g42020
RAPdb gene ID: Os12g0614600
Gene Symbol: OsPID OsPINOID
Genome: MSU7 , IRGSP-1.0
Species: Oryza sativa

Functional Descriptions

Constitutive overexpression of OsPID caused a variety of abnormalities, such as delay of adventitious root development, curled growth of shoots and agravitropism.
Analysis of OsPID mRNA distribution showed a complex pattern in shoot meristems, indicating that it probably plays a role in the pattern formation and organogenesis in the rice shoot.
Abnormalities observed in the plants that overexpress OsPID could be phenocopied by treatment with an inhibitor of active polar transport of auxin, indicating that OsPID could be involved in the control of polar auxin transport in rice.
Characterization of OsPID, the rice ortholog of PINOID, and its possible involvement in the control of polar auxin transport.
Interestingly, OsPID mutants did not display defects in flower initiation, nor did they develop any pin-like inflorescences, a characteristic phenotype observed in pid mutants in Arabidopsis (Arabidopsis thaliana) and maize (Zea mays).
Disruption of the rice PINOID (OsPID) gene completely eliminated the development of stigmas, and overexpression of OsPID led to over-proliferation of stigmas, suggesting that OsPID is a key determinant for stigma development.
The OsPID osnyp2 double mutants developed pin-like inflorescences, which were phenotypically similar to pid mutants in Arabidopsis and maize, demonstrating that the roles of OsPID in inflorescence development are likely masked by redundant partners.
Unlike the pid mutant that shows typical pin-like inflorescences in maize (Zea mays) and Arabidopsis (Arabidopsis thaliana), the OsPID mutant does not display any defects in inflorescence development and flower initiation.
Furthermore, the expression of most auxin response factor (ARF) genes was down-regulated, and OsETTIN1, OsETTIN2 and OsMONOPTEROS lost their rearrangements of expression patterns during pistil and stamen primordia development in OsPID.
The auxin activity in the young pistil of OsPID was lower than that in the wild-type pistil.
Moreover, the transcription of the floral meristem marker gene, OSH1, was down-regulated and FLORAL ORGAN NUMBER4 (FON4), the putative ortholog of Arabidopsis CLAVATA3 (CLV3), was up-regulated in the pistil primordium of OsPID.
These results suggested that the meristem proliferation in the pistil primordium might be arrested prematurely in OsPID.
Our data demonstrate that OsPID interacts with OsPIN1a and OsPIN1b to regulate polar auxin transport as shown previously.
Together, we propose a model that OsPID regulates floral organ development by modulating auxin polar transport and interaction with OsMADS16 and/or LAX1 in rice.
Additionally, OsPID also interacts with OsMADS16 to regulate transcription during floral organ development in rice.
These results provide a novel insight into the role of OsPID in regulating floral organ development of rice, especially in stigma development, which would be useful for genetic improvement of high-yield breeding of rice.

Functional Keywords

Literature and News

Gene Resources

Sequences

cDNA Sequence

>LOC_Os12g42020.1
ACTTCACCACCGCACAGCGAGCTCGCCGCGGAGAGCTTTCGCCGGAGAGGTAGACGACGACGGCGACGACAGTGTCACGTGCTCACGTTCATGGTGGCGGCGGTGCGCGCGCCGGTGAAGCCGGAGATGGTGGAGCTCTCGCCGGCGGCGATGGAGAGGTACTCCTCCGACGCCGACACGACGGCGCCGAACTCGAGCCTTAGCTCGGCGGCGAGCAGCACGGGGAGCCTCGCGCGGTGCTCGAGCCTGTCGCGCCTGTCGTTCGACTGCTCGCCGTCGGCCGCCGTGGCGGCGGCGGCGACGTCGTGCTCGCCGCCGCGGGCGTCGGTGCTGTTGCGGCCGCACAGGTCCGGCGACGTCGCGTGGGCGGCCATCCGCGCGGCTTCGACGACCTCCGCGGCGCCGCTAGGCCCGCGGGACTTCAAGCTCGTGCGGCGCATCGGCGGCGGCGACATCGGGACGGTGTACCTGTGCCGCCTCCGGAGCTCGCCGGAGAGGGAGAGCCCGTGCATGTACGCGATGAAGGTGGTGGACCGGAGGGCGGTGGCGAGGAAGCAGAAGCTGGGGCGCGCGGCGGCGGAGAAGCGGATCCTGCGGCAGCTGGACCACCCCTTCCTCCCCACCCTCTTCGCCGACTTCGACGCCACGCCGCACTTCTCCTGCGCCGTCATGGAGTTCTGCCCCGGCGGCGACCTCCACTCCCTCCGCCACCGCATGCCGTCCCGCCGCTTCCCGCTCCCCTCCGCCCGCTTCTACGCCGCCGAGGTGCTCCTCGCCATCGAGTACCTCCACATGATGGGCATCGTCTACCGCGACCTCAAGCCCGAGAACGTCCTCATCCGCGCCGACGGCCACATCATGCTCACCGACTTCGACCTCTCGCTGCAGTCCACCACCTCGCCGTCTCTCGACGGCGACACCGACACCGACGACGAGGCCAGCGGTGGCGCGTCCTGCTTCCCGGACCACCTCCTCCGGTTCAAGCGGCGGCGGAACGCCGTGGCGGCGCCGCGTCCGCGGTTCGTGGCGGAGCCGGTGGATGCGAGGTCGTGCTCGTTCGTGGGGACGCACGAGTACGTGGCCCCCGAGGTGGCGAGCGGCGGCGCGCATGGCGCGGCCGTGGACTGGTGGGCGTACGGGGTGTTCCTCTACGAGCTCATCTACGGCCGTACGCCGTTCGCCGGCGCTACAAACGAGGCGACGCTCCGCAACATCGTCCGCCGCCCGCTCGCCTTCCCCTCCGGCTCCGGCTCGTGCGGTCCCGCCGACGCCGACGCGCGCGACCTCATCGCCCGCCTCCTCGCCAAGGACCCCGCCGCCCGCCTCGGCTCCCGCCGCGGCGCCGCCGACGTCAAGTCCCACCCCTTCTTCAAGTCCCTCAACCTCGCCCTCCTCCGTTCGTCGCGCCCGCCCGTCGTCCCCGGCGCCGGCGCCGGCGCCGCGCCGCTACACCGGTCGCAGTCGTGCAAGGCGGCGCCGACAACGCCGCCGCCGCCGACGACGACGAAGCCGGCGAACGCCACCGCGCGGTTCGACCTCTTCTGAGCATATTGACCGTTGCTGTCTGCTACTACCTACCCGCGTCGTCGCCGACATCGCCGGCGGGAGACACGCTCCGGCCACCGTGACATTAATTTCTCGTTGACCCTTAGCTACCGCGTTGAATGTACACACTGTTAATTAATTACTACTCCTAGTTAATCACTGCTAATCACCTTGCTGTTAGTACTACTAAACTAATATAATCTAGTGGCTTAATTAATCAGCTTGCTTTGAGTGATA

CDS Sequence

>LOC_Os12g42020.1
ATGGTGGCGGCGGTGCGCGCGCCGGTGAAGCCGGAGATGGTGGAGCTCTCGCCGGCGGCGATGGAGAGGTACTCCTCCGACGCCGACACGACGGCGCCGAACTCGAGCCTTAGCTCGGCGGCGAGCAGCACGGGGAGCCTCGCGCGGTGCTCGAGCCTGTCGCGCCTGTCGTTCGACTGCTCGCCGTCGGCCGCCGTGGCGGCGGCGGCGACGTCGTGCTCGCCGCCGCGGGCGTCGGTGCTGTTGCGGCCGCACAGGTCCGGCGACGTCGCGTGGGCGGCCATCCGCGCGGCTTCGACGACCTCCGCGGCGCCGCTAGGCCCGCGGGACTTCAAGCTCGTGCGGCGCATCGGCGGCGGCGACATCGGGACGGTGTACCTGTGCCGCCTCCGGAGCTCGCCGGAGAGGGAGAGCCCGTGCATGTACGCGATGAAGGTGGTGGACCGGAGGGCGGTGGCGAGGAAGCAGAAGCTGGGGCGCGCGGCGGCGGAGAAGCGGATCCTGCGGCAGCTGGACCACCCCTTCCTCCCCACCCTCTTCGCCGACTTCGACGCCACGCCGCACTTCTCCTGCGCCGTCATGGAGTTCTGCCCCGGCGGCGACCTCCACTCCCTCCGCCACCGCATGCCGTCCCGCCGCTTCCCGCTCCCCTCCGCCCGCTTCTACGCCGCCGAGGTGCTCCTCGCCATCGAGTACCTCCACATGATGGGCATCGTCTACCGCGACCTCAAGCCCGAGAACGTCCTCATCCGCGCCGACGGCCACATCATGCTCACCGACTTCGACCTCTCGCTGCAGTCCACCACCTCGCCGTCTCTCGACGGCGACACCGACACCGACGACGAGGCCAGCGGTGGCGCGTCCTGCTTCCCGGACCACCTCCTCCGGTTCAAGCGGCGGCGGAACGCCGTGGCGGCGCCGCGTCCGCGGTTCGTGGCGGAGCCGGTGGATGCGAGGTCGTGCTCGTTCGTGGGGACGCACGAGTACGTGGCCCCCGAGGTGGCGAGCGGCGGCGCGCATGGCGCGGCCGTGGACTGGTGGGCGTACGGGGTGTTCCTCTACGAGCTCATCTACGGCCGTACGCCGTTCGCCGGCGCTACAAACGAGGCGACGCTCCGCAACATCGTCCGCCGCCCGCTCGCCTTCCCCTCCGGCTCCGGCTCGTGCGGTCCCGCCGACGCCGACGCGCGCGACCTCATCGCCCGCCTCCTCGCCAAGGACCCCGCCGCCCGCCTCGGCTCCCGCCGCGGCGCCGCCGACGTCAAGTCCCACCCCTTCTTCAAGTCCCTCAACCTCGCCCTCCTCCGTTCGTCGCGCCCGCCCGTCGTCCCCGGCGCCGGCGCCGGCGCCGCGCCGCTACACCGGTCGCAGTCGTGCAAGGCGGCGCCGACAACGCCGCCGCCGCCGACGACGACGAAGCCGGCGAACGCCACCGCGCGGTTCGACCTCTTCTGA

Protein Sequence

>LOC_Os12g42020.1
MVAAVRAPVKPEMVELSPAAMERYSSDADTTAPNSSLSSAASSTGSLARCSSLSRLSFDCSPSAAVAAAATSCSPPRASVLLRPHRSGDVAWAAIRAASTTSAAPLGPRDFKLVRRIGGGDIGTVYLCRLRSSPERESPCMYAMKVVDRRAVARKQKLGRAAAEKRILRQLDHPFLPTLFADFDATPHFSCAVMEFCPGGDLHSLRHRMPSRRFPLPSARFYAAEVLLAIEYLHMMGIVYRDLKPENVLIRADGHIMLTDFDLSLQSTTSPSLDGDTDTDDEASGGASCFPDHLLRFKRRRNAVAAPRPRFVAEPVDARSCSFVGTHEYVAPEVASGGAHGAAVDWWAYGVFLYELIYGRTPFAGATNEATLRNIVRRPLAFPSGSGSCGPADADARDLIARLLAKDPAARLGSRRGAADVKSHPFFKSLNLALLRSSRPPVVPGAGAGAAPLHRSQSCKAAPTTPPPPTTTKPANATARFDLF*