Gene Details:
- MSU gene ID: LOC_Os11g37280
- RAPdb gene ID: Os11g0582500
- Gene Symbol: OsC6
- Genome: MSU7 , IRGSP-1.0
- Species: Oryza sativa
Functional Descriptions:
- Immunological assays indicated that OsC6 is widely distributed in anther tissues such as the tapetal cytoplasm, the extracellular space between the tapetum and middle layer, and the anther locule and anther cuticle.
- Here, we report the crucial role of OsC6 in regulating postmeiotic anther development in rice (Oryza sativa).
- OsC6 expression is mainly detectable in tapetal cells and weakly in microspores from stage 9 to stage 11 of anther development.
- These data suggest that OsC6 plays a crucial role in the development of lipidic orbicules and pollen exine during anther development in rice.
- OsC6, encoding a lipid transfer protein, is required for postmeiotic anther development in rice.
- The expression levels of OsC6, OsRAFTIN and TDR, which are tapetum-specific genes, were unaffected by high temperatures.
- Extra granule-like structures were observed on the inner surface of the tdr tapetal layer when the expression of OsC6 was driven by the TDR promoter compared with the tdr mutant.
- Furthermore, additional evidence is provided that the expression of OsC6 is positively regulated by a basic helix-loop-helix transcription factor, Tapetum Degeneration Retardation (TDR).
Function-related keywords:
- cuticle , anther-development , pollen , microspore , tapetum , tapetal , temperature , transcription-factor , meiotic , anther
Literature:
- High temperatures cause male sterility in rice plants with transcriptional alterations during pollen development . DOI: 10.1093/pcp/pcp135 ; PMID: 19808807
- OsC6, encoding a lipid transfer protein, is required for postmeiotic anther development in rice . DOI: 10.1104/pp.110.158865 ; PMID: 20610705
- The rice tapetum degeneration retardation gene is required for tapetum degradation and anther development . DOI: 10.1105/tpc.106.044107 ; PMID: 17138695
- OsMS188 Is a Key Regulator of Tapetum Development and Sporopollenin Synthesis in Rice . DOI: 10.1186/s12284-020-00451-y ; PMID: 33409767
Related News:
Gene Resources:
- NCBI ID: AK064672
- UniProt accessions:
Sequences:
cDNA Sequence
- >LOC_Os11g37280.1
ACACACACTCCCATCACTCCAATTAACCAAAGCTAATTAAGCTAGCTCAAGCTCTAATCCACATTTAGCTAGAATGGCGCCGTCCAAGTCCACAGCCGCCGCCGGCGTCCTCCTCGTCCTGCTCGTCGCGGCGGCGGGCGGCGGCGCAGAGGCGGCGGCGACGACGTGCGTGGCGTCGCTGCTGGAGCTGAGCCCGTGCCTGCCGTTCTTCAAGGACAAGGCGGCGACGGCGGCGCCGGAGGGGTGCTGCGCGGGGCTGTCGTCCATCGTGAAGGGGGAGGCGGTGTGCCTGTGCCACATCGTGAACCACACCCTGGAGCGCGCCATCGGCGTCGACATCCCCGTCGACCGCGCCTTCGCCCTCCTCCGCGACGTCTGCCGCCTCTCGCCGCCGGCGGACATCATCTCCACCTGCGCCAACGAGAAAGGTGGTGTGCCGCCTCTCTACTCTTGCCCGGCTCCATCTGCCTGAGTATATATGAGAAAAGAATAAATGTTACCAAAGGAGGGATTTCAACATATCTAAAAGTCAAGATGGAGTAACTTTGGTATACAAGACCAACATATATATCACGTTGTTAAAGGACAAGTAGATATTGGATTATTGGCATATACTGATATATCCATGCTAATATTAGTATATGTATATTCTGCAACATGCATGGACATACACATTGTCAAATGAAGTACTAAGTAACACGGAACGTGTACTAGCTCGTGCTACTGTCGTGCTATGCGCTGTCAATAGAAATAAAATATTTTACATTGTGGTATTAAGCATTAAAGCCATATTGTATTCTAATATTATCGGGCGGAGATTGCGGATTATTCCTACCACACTTTTAAATAATTACAATTTCTCTAAAAAAAAGTTGCTATGTCAGTATTTTTTACAGCACTTGTTTATCTCTACTATTATAAAAATTTAAGATGTTTTTGTC
CDS Sequence
- >LOC_Os11g37280.1
ATGGCGCCGTCCAAGTCCACAGCCGCCGCCGGCGTCCTCCTCGTCCTGCTCGTCGCGGCGGCGGGCGGCGGCGCAGAGGCGGCGGCGACGACGTGCGTGGCGTCGCTGCTGGAGCTGAGCCCGTGCCTGCCGTTCTTCAAGGACAAGGCGGCGACGGCGGCGCCGGAGGGGTGCTGCGCGGGGCTGTCGTCCATCGTGAAGGGGGAGGCGGTGTGCCTGTGCCACATCGTGAACCACACCCTGGAGCGCGCCATCGGCGTCGACATCCCCGTCGACCGCGCCTTCGCCCTCCTCCGCGACGTCTGCCGCCTCTCGCCGCCGGCGGACATCATCTCCACCTGCGCCAACGAGAAAGGTGGTGTGCCGCCTCTCTACTCTTGCCCGGCTCCATCTGCCTGA
Protein Sequence
- >LOC_Os11g37280.1
MAPSKSTAAAGVLLVLLVAAAGGGAEAAATTCVASLLELSPCLPFFKDKAATAAPEGCCAGLSSIVKGEAVCLCHIVNHTLERAIGVDIPVDRAFALLRDVCRLSPPADIISTCANEKGGVPPLYSCPAPSA*