Information report for OsMPK6;OsMPK4
Gene Details
|
|
Functional Descriptions
- An MBP (myelin basic protein) kinase assay of the immunoprecipitation complex indicated that OsMPK3 and OsMPK6 were activated in response to a moderately low temperature (12 degrees C), but not a severely low temperature (4 degrees C) in rice seedlings.
- Activation of OsMPK6 resulted in the formation of lesion mimics and local resistance to Xoo, accompanied by the accumulation of salicylic acid (SA) and jasmonic acid (JA), and the induced expression of SA- and JA-signaling genes.
- These results suggest that OsMPK6 functions as a repressor to regulate rice defense responses upon bacterial invasion.
- Nuclear localization of OsMPK6 was essential for local resistance, suggesting that modulating the expression of defense-responsive genes through transcription regulators may be the primary mechanism of OsMPK6-mediated local resistance.
- Here we report that OsMPK6 is an important regulator in rice disease resistance.
- Mitogen-activated protein kinase OsMPK6 negatively regulates rice disease resistance to bacterial pathogens.
- The knock-out of OsMPK6 resulted in enhanced Xoo resistance, increased accumulation of SA and enhanced resistance to X.
- Xoo infection induced the expression of PR1a, the marker gene of systemic acquired resistance (SAR), in systemic health tissues of OsMPK6-knock-out plants.
- Here, immunoprecipitated OsMPK3 and OsMPK6 were initially activated in 15min, and this activation transiently increased in rice seedlings under H2O2 stress.
- A redox-sensitive cysteine residue regulates the kinase activities of OsMPK3 and OsMPK6 in vitro.
- An ABA treatment dephosphorylated/inactivated OsMPK6 via protein tyrosine phosphatases, OsPTP1/2, leading to the impaired activation of WRKY45 and a reduction in Magnaporthe oryzae resistance, even after BTH treatment.
- WRKY45 is a central regulator of disease resistance mediated by salicylic acid signaling in rice and its activation involves phosphorylation by OsMPK6.
- Expressing OsMPK4 Impairs Plant Growth but Enhances the Resistance of Rice to the Striped Stem Borer Chilo suppressalis.
- The overexpression of OsMPK4 (oe-MPK4) enhanced constitutive and/or SSB-induced levels of JA, jasmonoyl-l-isoleucine (JA-Ile), ethylene (ET), and SA, as well as the activity of elicited trypsin proteinase inhibitors (TrypPIs), and reduced SSB performance.
- Using transgenic plants defective in early signaling, we show that OsMPK3 is required, and that OsMPK6 and OsWRKY70 contribute to indole-mediated defense priming of JA-dependent herbivore resistance.
- OsMPK6 directly interacts with and phosphorylates the zinc finger transcription factor DST to enhance its transcriptional activation of CYTOKININ OXIDASE2 (OsCKX2), indicating that the OsER1-OsMKKK10-OsMKK4-OsMPK6 pathway shapes panicle morphology by regulating cytokinin metabolism.
- Furthermore, overexpression of either DST or OsCKX2 rescued the spikelet number phenotype of the oser1, osmkkk10, osmkk4, and OsMPK6 mutants, suggesting that the DST-OsCKX2 module genetically functions downstream of the OsER1-OsMKKK10-OsMKK4-OsMPK6 pathway.
- Reduction of OsMPK6 activity by a R89K mutation induces cell death and bacterial blight resistance in rice.
- Compared with wild type, the OsMPK6 mutant exhibited high resistance to the bacterial pathogen Xanthomonas oryzae pv.
- By contrast, the OsMPK6-overexpression line (OE-1) was found to be susceptible to the bacterial pathogens, indicating that OsMPK6 negatively regulated Xoo resistance.
- The R89 is essential for the kinase activity of OsMPK6 which negatively regulates cell death and defense response in rice.
- Our findings provide insight into a vital role of the R89 of OsMPK6 in regulating cell death and defense response in rice.
- Map-based cloning and complementation demonstrated that a G702A single-base substitution in the second exon of OsMPK6 led to the lesion mimic phenotype of the OsMPK6 mutant.
- Here, we identified and characterized a rice lesion mimic mutant OsMPK6 which displayed hypersensitive response-like lesions in company with cell death and hydrogen peroxide hyperaccumulation.
- OsMPK6 encodes a cytoplasm and nucleus-targeted mitogen-activated protein kinase and is expressed in the various organs.
- Furthermore, the G702A single-base substitution caused a R89K mutation at both polypeptide substrate-binding site and active site of OsMPK6, and kinase activity assay revealed that the R89K mutation led to reduction of OsMPK6 activity, suggesting that the R89 is essential for the function of OsMPK6.
- SCRE6 interacts with and dephosphorylates the negative immune regulator OsMPK6 in rice, thus enhancing its stability and suppressing plant immunity.
- OsMPK4 promotes phosphorylation and degradation of IPA1 in response to salt stress to confer salt tolerance in rice.
- Under salt stress, OsMPK4 could interact with IPA1 and phosphorylate IPA1 at Thr180, leading to degradation of IPA1.
- Genetic evidence shows that IPA1 is a negative regulator of salt tolerance in rice, whereas OsMPK4 promotes salt response in an IPA1-dependent manner.
Functional Keywords
- seedling , jasmonic , defense , defense-response , transcription-regulator , salicylic-acid , disease-resistance , temperature , sa , disease , jasmonic-acid , xoo , stress , seedlings , Kinase , ABA , magnaporthe-oryzae , resistance , stem , growth , ethylene , plant-growth , transcription-factor , panicle , spikelet , cytokinin , spikelet-number , zinc , blight , bacterial-blight , map-based-cloning , cell-death , pathogen , cytoplasm , protein-kinase , kinase , lesion , lesion-mimic , immunity , salt , tolerance , salt-tolerance , salt-stress
Literature and News
- Mitogen-activated protein kinase OsMPK6 negatively regulates rice disease resistance to bacterial pathogens . DOI: 10.1007/s00425-007-0541-z ; PMID: 17541629
- OsWRKY30 is activated by MAP kinases to confer drought tolerance in rice . DOI: 10.1007/s11103-012-9941-y ; PMID: 22875749
- Biochemical identification of the OsMKK6-OsMPK3 signalling pathway for chilling stress tolerance in rice . DOI: 10.1042/BJ20111792 ; PMID: 22248149
- Opposite functions of a rice mitogen-activated protein kinase during the process of resistance against Xanthomonas oryzae . DOI: 10.1111/j.1365-313X.2010.04306.x ; PMID: 20663089
- Molecular analysis of the rice MAP kinase gene family in relation to Magnaporthe grisea infection . DOI: 10.1094/MPMI-19-0530 ; PMID: 16673940
- A calmodulin-binding mitogen-activated protein kinase phosphatase is induced by wounding and regulates the activities of stress-related mitogen-activated protein kinases in rice . DOI: 10.1093/pcp/pcm007 ; PMID: 17218330
- A cold-induced thioredoxin h of rice, OsTrx23, negatively regulates kinase activities of OsMPK3 and OsMPK6 in vitro . DOI: 10.1016/j.febslet.2009.07.057 ; PMID: 19665023
- A redox-sensitive cysteine residue regulates the kinase activities of OsMPK3 and OsMPK6 in vitro . DOI: 10.1016/j.plantsci.2014.07.002 ; PMID: 25219308
- Abiotic Stresses Antagonize the Rice Defence Pathway through the Tyrosine-Dephosphorylation of OsMPK6 . DOI: 10.1371/journal.ppat.1005231 ; PMID: 26485146
- OsMPK6 plays a critical role in cell differentiation during early embryogenesis in Oryza sativa . DOI: 10.1093/jxb/erw052 ; PMID: 26912801
- Discovery of rice essential genes by characterizing a CRISPR-edited mutation of closely related rice MAP kinase genes . DOI: 10.1111/tpj.13399 ; PMID: 27747971
- WRKY45 phosphorylation at threonine 266 acts negatively on WRKY45-dependent blast resistance in rice . DOI: 10.1080/15592324.2017.1356968 ; PMID: 28758876
- Expressing OsMPK4 Impairs Plant Growth but Enhances the Resistance of Rice to the Striped Stem Borer Chilo suppressalis . DOI: 10.3390/ijms19041182 ; PMID: 29652796
- Molecular Dissection of Early Defense Signaling Underlying Volatile-Mediated Defense Regulation and Herbivore Resistance in Rice . DOI: 10.1105/tpc.18.00569 ; PMID: 30760558
- ERECTA1 Acts Upstream of the OsMKKK10-OsMKK4-OsMPK6 Cascade to Control Spikelet Number by Regulating Cytokinin Metabolism in Rice . DOI: 10.1105/tpc.20.00351 ; PMID: 32616661
- Magnaporthe oryzae systemic defense trigger 1 (MoSDT1)-mediated metabolites regulate defense response in Rice . DOI: 10.1186/s12870-020-02821-6 ; PMID: 33430779
- OrMKK3 Influences Morphology and Grain Size in Rice . DOI: 10.1007/s12374-020-09290-2 ; PMID: 33424241
- Pathogen-inducible OsMPKK10.2-OsMPK6 cascade phosphorylates the Raf-like kinase OsEDR1 and inhibits its scaffold function to promote rice disease resistance . DOI: 10.1016/j.molp.2021.01.008 ; PMID: 33450368
- Reduction of OsMPK6 activity by a R89K mutation induces cell death and bacterial blight resistance in rice . DOI: 10.1007/s00299-021-02679-4 ; PMID: 33730215
- Ustilaginoidea virens secretes a family of phosphatases that stabilize the negative immune regulator OsMPK6 and suppress plant immunity . DOI: 10.1093/plcell/koac154 ; PMID: 35639755
- OsMPK4 promotes phosphorylation and degradation of IPA1 in response to salt stress to confer salt tolerance in rice . DOI: 10.1016/j.jgg.2022.06.009 ; PMID: 35803541
Gene Resources
- UniProt: Q336X9
- EMBL: AC092389, AK111579, AP008216
- AlphaFoldDB: Q336X9
- EnsemblPlants: Os10t0533600-01
- Gramene: Os10t0533600-01
- KEGG: dosa:Os10g0533600
- Orthologous matrix: SFFDFDY
- InterPro: IPR000719, IPR003527, IPR008271
Sequences
cDNA Sequence
- >LOC_Os10g38950.1
GTGTTTGGGTGTGATCACCCTTTGATTGACCCGCACCCGCATCCCTTTCCCGCAAGGCCGCAACACCGTCCGTCGCCGCCTCCGCCTCGCTCCGATCCCCATTCCGCGGTCGCCGCCCGAGTCAAAAAGAGGGGGAAGCTTCTCCCACCATAGTCCTCCTCCTCCTCCTCCTACTCCCATCAACGACTAGTCGCGGCGACCAAGAGCCAAACCCTACGCCTCCTCCCCTCCCCCTCCACCTCGTCCTCCCCGCGAGCGGCGGCGGCCATGGATTCCTCCTCCGGCGGCGCGGGCGGCGGCGGCGGCGCGCAGATCAAGGGGATGGGGACGCACGGGGGCCGCTACGTGCTGTACAACGTGTACGGGAACTTCTTCGAGGTCTCCTCCAAGTACGCCCCTCCCATCCGCCCCATCGGCCGGGGCGCCTACGGCATTGTCTGCGCGGCTGTTAACTCGGAGAACGGCGAGGAAGTTGCCATCAAGAAGATTGGCAATGCATTCGACAACCATATCGATGCCAAGCGGACACTGAGAGAAATCAAGCTGCTTCGCCACATGGACCACGAGAATATTATTGCCATAAAGGACATAATTCGCCCCCCAAGAAGAGACAACTTTAATGATGTTTACATTGTTTCTGAGTTGATGGATACTGATCTCCATCAGATCATACGCTCAAATCAACCATTGACTGATGACCACTGCCAGTACTTCCTGTACCAGTTGCTACGAGGGCTAAAATATGTGCACTCGGCAAATGTCTTGCACCGTGATCTGAAGCCAAGCAATTTGTTCCTTAATGCAAATTGTGATCTCAAGATTGCTGATTTTGGGCTTGCAAGAACCACTACGGAGACTGACCTCATGACAGAGTATGTGGTCACTCGTTGGTATCGAGCACCAGAGCTGCTGTTGAACTGCTCGCAGTATACTGCTGCTATTGATGTCTGGTCAGTTGGATGCATACTTGGTGAAATTGTGACTCGTCAACCCCTGTTTCCTGGAAGGGATTACATTCAGCAACTAAAATTGATCACTGAGCTGATAGGGTCGCCAGATGACTCAAGCCTAGGGTTTCTTCGGAGTGATAATGCAAGAAGATACATGAAACAGCTACCACAGTACCCAAGGCAGGACTTCCGCTTGCGCTTCCGCAACATGTCTGCTGGTGCAGTCGATCTGTTAGAGAAAATGCTGGTGTTTGACCCAAGCAGACGGATAACTGTTGATGAGGCTCTTCATCACCCATACTTGGCTTCTCTTCATGACATCAATGAAGAACCCACCTGCCCAGCACCTTTCAGCTTTGATTTTGAGCAACCATCCTTTACTGAAGAACATATAAAAGAACTCATCTGGAGGGAATCCTTGGCATTTAATCCGGATCCTCCCTACTAAGAGCTCAGAGCAATTTATCAATGCTGGCATCTGAAGATCGGTAGCTCTAGAAAAGCCAAATCCCCTTGCTTTGTGCATCTATTAATTTTATGCCCACTTGTTGGGCGAATGAGCATGGATTATTGTTATAGTGACAATTTTTCTTAAGGCCTGTCTAAAGAAACAACATTTGTATTCCTTATCAGATAGCCTGAACTTGGGCCTGTATTATACCGGTTGATTGCATAACTGTTCTTATGTATCTAAGCCTGTAATTGTCTTCACAATGGCTTGAACTGCCCGTGTATATCTGAGTTGACATCTTCTCTCTGATATTATCCCATCCATGTTATTTCCA
CDS Sequence
- >LOC_Os10g38950.1
ATGGATTCCTCCTCCGGCGGCGCGGGCGGCGGCGGCGGCGCGCAGATCAAGGGGATGGGGACGCACGGGGGCCGCTACGTGCTGTACAACGTGTACGGGAACTTCTTCGAGGTCTCCTCCAAGTACGCCCCTCCCATCCGCCCCATCGGCCGGGGCGCCTACGGCATTGTCTGCGCGGCTGTTAACTCGGAGAACGGCGAGGAAGTTGCCATCAAGAAGATTGGCAATGCATTCGACAACCATATCGATGCCAAGCGGACACTGAGAGAAATCAAGCTGCTTCGCCACATGGACCACGAGAATATTATTGCCATAAAGGACATAATTCGCCCCCCAAGAAGAGACAACTTTAATGATGTTTACATTGTTTCTGAGTTGATGGATACTGATCTCCATCAGATCATACGCTCAAATCAACCATTGACTGATGACCACTGCCAGTACTTCCTGTACCAGTTGCTACGAGGGCTAAAATATGTGCACTCGGCAAATGTCTTGCACCGTGATCTGAAGCCAAGCAATTTGTTCCTTAATGCAAATTGTGATCTCAAGATTGCTGATTTTGGGCTTGCAAGAACCACTACGGAGACTGACCTCATGACAGAGTATGTGGTCACTCGTTGGTATCGAGCACCAGAGCTGCTGTTGAACTGCTCGCAGTATACTGCTGCTATTGATGTCTGGTCAGTTGGATGCATACTTGGTGAAATTGTGACTCGTCAACCCCTGTTTCCTGGAAGGGATTACATTCAGCAACTAAAATTGATCACTGAGCTGATAGGGTCGCCAGATGACTCAAGCCTAGGGTTTCTTCGGAGTGATAATGCAAGAAGATACATGAAACAGCTACCACAGTACCCAAGGCAGGACTTCCGCTTGCGCTTCCGCAACATGTCTGCTGGTGCAGTCGATCTGTTAGAGAAAATGCTGGTGTTTGACCCAAGCAGACGGATAACTGTTGATGAGGCTCTTCATCACCCATACTTGGCTTCTCTTCATGACATCAATGAAGAACCCACCTGCCCAGCACCTTTCAGCTTTGATTTTGAGCAACCATCCTTTACTGAAGAACATATAAAAGAACTCATCTGGAGGGAATCCTTGGCATTTAATCCGGATCCTCCCTACTAA
Protein Sequence
- >LOC_Os10g38950.1
MDSSSGGAGGGGGAQIKGMGTHGGRYVLYNVYGNFFEVSSKYAPPIRPIGRGAYGIVCAAVNSENGEEVAIKKIGNAFDNHIDAKRTLREIKLLRHMDHENIIAIKDIIRPPRRDNFNDVYIVSELMDTDLHQIIRSNQPLTDDHCQYFLYQLLRGLKYVHSANVLHRDLKPSNLFLNANCDLKIADFGLARTTTETDLMTEYVVTRWYRAPELLLNCSQYTAAIDVWSVGCILGEIVTRQPLFPGRDYIQQLKLITELIGSPDDSSLGFLRSDNARRYMKQLPQYPRQDFRLRFRNMSAGAVDLLEKMLVFDPSRRITVDEALHHPYLASLHDINEEPTCPAPFSFDFEQPSFTEEHIKELIWRESLAFNPDPPY*