Gene Details:

Functional Descriptions:

  • In this work, we describe the cloning and characterization of the full-length cDNA encoding OsGR3, a chloroplast-localized GR that up to now was considered as a non-functional enzyme because of assumed lack of N-terminal conserved domains.
  • OsGR3 shows 76 and 53 % identity with OsGR1 (chloroplastic) and OsGR2 (cytosolic), respectively.
  • A plastid transit peptide is located at the N terminus of OsGR3, and genetic transformation of rice with a GR3-GFP fusion construct further confirmed its localization in chloroplasts.
  • Furthermore, OsGR1 and OsGR3 are also targeted to mitochondria, which suggest a combined antioxidant mechanism in both chloroplasts and mitochondria.
  • In addition, the transcript level of OsGR3 was greatly increased with salicylic acid treatment but was not significantly affected by methyl jasmonate, dehydration or heat shock stress.
  • In fact, exogenous application of ABA enhanced the expression of OsGR2 and OsGR3 in rice roots.
  • On inhibiting ABA accumulation with sodium tungstate (Tu), an inhibitor of ABA biosynthesis, the expression of OsGR2 and OsGR3 was still induced by NaCl; therefore, NaCl-triggered expression of OsGR2 and OsGR3 in rice roots is not mediated by accumulation of ABA.
  • However, both isoforms showed a distinct response to salinity: the expression of OsGR3 but not OsGR1 was induced by salt stress.
  • Our results provide new clues about the possible roles of functional OsGR3 in salt stress and biotic stress tolerance.
  • Semi-quantitative RT-PCR was used to quantify the mRNA levels for one cytosolic (OsGR2) and two chloroplastic (OsGR1 and OsGR3) isoforms of GR identified in the rice genome.
  • Semi-quantitative RT-PCR was applied to quantify the mRNA levels for one cytosolic (OsGR2) and two chloroplastic (OsGR1 and OsGR3) isoforms of glutathione reductase identified in the rice genome.
  • The expression of OsGR2 and OsGR3 but not OsGR1 was increased in rice roots treated with NaCl.
  • NaCl-induced OsGR2 and OsGR3 in rice roots could be associated with Na(+) but not an osmotic component.
  • The expression of OsGR2 and OsGR3 but not OsGR1 was increased in rice roots treated with 150 mM NaCl.
  • However, NaCl treatment could induce H2O2 production in rice roots, and H2O2 treatment resulted in enhanced OsGR2 and OsGR3 induction.
  • Moreover, the increase in H2O2 level was prior to the induction of OsGR2 and OsGR3 in NaCl-treated rice roots.
  • Thus, H2O2, but not ABA, is involved in regulation of OsGR2 and OsGR3 expression in NaCl-treated rice roots.
  • GR3 promoter-GUS was expressed in the vascular cylinder and cortex of root tissues in rice seedlings, vascular tissue of nodes, embryo and aleurone layer of seeds, and young flowers.
  • Previously, we showed that salt-stress-responsive GR3 is a functional protein localized in chloroplasts and mitochondria in rice.
  • Rice GR3 was primarily expressed in roots at the seedling stage and ubiquitously expressed in all tissues except the sheath at heading stage.
  • Oxidative stress, indicated by malondialdehyde content, was greater in GR3 than the WT under salt stress.
  • As compared with the WT, GR3 was sensitive to salt and methyl viologen; it showed inhibited growth, decreased maximal efficiency of photosystem II, decreased GSH and GSSG contents, and the ratio of GSH to GSSG.
  • These results reveal that GR3 plays an important role in salt stress tolerance by regulating the GSH redox state in rice.
  • To learn more about the role of GR3 in salt-stress tolerance, we investigated the response to 100 mM NaCl treatment in wild-type rice (WT); GR3 knockout mutant of rice (GR3); and the functional GR3-complementation line (C1).

Literature:

Gene Resources:

Sequences:

cDNA Sequence
  • >LOC_Os10g28000.1
    CTGATGACCAACAAGAATTTAGAGTTGCAGCGCTTGGTGGGGGTTCAGACAAACATGCTAAAGAATTCTGGGGTCACTATAATTGAAGGCCGTGGAAAGGTTGTTGATCCACATACTGTCAGTGTTGATGGAAAGCTTTATACTGCAAAAAACATACTCATTGCAGTTGGTGGTCGGCCATCCATGCCAGACATTCCAGGGATAGAGCATGTTATTGATTCAGATGCAGCATTGGACCTGCCTTCAAGACCTGAGAAGATTGCGATAGTAGGAGGAGGGTATATTGCTTTGGAGTTTGCTGGCATTTTCAATGGCTTAAAAAGTGGTGTTCATGTTTTCATCCGACAGAAGAAAGTACTGAGAGGCTTTGATGAGGAGGTCAGGGATTTTGTTGCCGATCAGATGTCTTTGAGGGGTATCACATTTCATACCGAAGAGACTCCTCAAGCAGTAATGAAATCAGACGATGGCTTGCTGACTCTGACGACAAACAAAGGAAGCATAAATGGGTTCTCACATGTAATGTTTGCAACAGGACGAAAACCAAATACAAAGAATTTGGGTCTAGAAGAGGTTGGGGTCAAAATGGACAAGCATGGTGCTATTGTGGTTGATGAGTTCTCTCGAACCTCAGTTGATTCTATATGGGCTGTGGGTGATGTTACTAACAGGGTGAACTTGACACCGGTTGCATTAATGGAAGGTGGGGCATTAGCAAGGACTATTTTTGGCAATGAACCTACAAAACCAGATTACAGTGCTGTGCCATCTGCGGTGTTTTCCCAACCTCCAATTGGACAAGTTGGACTCACTGAAGAGAAGGCGATCGAAAAGTATGGAGATGTTGATGTCTACACATCAAACTTCAGACCTCTCAGGGCCACTCTTTCTGGTCTACCTGATCGTGTATACATGAAGGTTATCGTGTGTGCTAATACTAACAAAGTTCTAGGAGTGCACGTGTGTGGTGAAGATGCACCCGAGATTATTCAGGGTATTGCAATTGCTGTAAAGGCTGGGTTGATGAAGCAAAACTTTGATGCCACCATAGGTGTCCACCCAACCACTGCAGAAGAACTTGTCACAATGAGAAGCCCGACTAGGAAGGTCCGGAGAGATGCTGTGGATGAGGCCAAAATGAAAGATGAGGCCACAAGTCAGAAGTAGATACACCTGCCCTGCATAAATGAGTCTGACCAGTCGATTTCTAACCGCGGAAACAACAGACAGATATCGGTATTTCGAGCAGTACCAGAGAAATCCAACCCACGATTGCAGCCAGTGAAGAACGGAGATGAGTTACAGCAAATGGCTAGCTATCTCGTATATTGCATGGTTTATAAGTTCATTATTATAGAAACCAGCTCAAGTTCCTTTTATTTTTTTGGCCTAACATGTTACTGAAAGAAATGCTTCAGGTCCCGGTCAAAAAAAAGAAAGAAATGCTTCAGGATGTTGATAGTATTGCCGCATGAAATTTTTTGATTAAACAAC
CDS Sequence
  • >LOC_Os10g28000.1
    ATGACCAACAAGAATTTAGAGTTGCAGCGCTTGGTGGGGGTTCAGACAAACATGCTAAAGAATTCTGGGGTCACTATAATTGAAGGCCGTGGAAAGGTTGTTGATCCACATACTGTCAGTGTTGATGGAAAGCTTTATACTGCAAAAAACATACTCATTGCAGTTGGTGGTCGGCCATCCATGCCAGACATTCCAGGGATAGAGCATGTTATTGATTCAGATGCAGCATTGGACCTGCCTTCAAGACCTGAGAAGATTGCGATAGTAGGAGGAGGGTATATTGCTTTGGAGTTTGCTGGCATTTTCAATGGCTTAAAAAGTGGTGTTCATGTTTTCATCCGACAGAAGAAAGTACTGAGAGGCTTTGATGAGGAGGTCAGGGATTTTGTTGCCGATCAGATGTCTTTGAGGGGTATCACATTTCATACCGAAGAGACTCCTCAAGCAGTAATGAAATCAGACGATGGCTTGCTGACTCTGACGACAAACAAAGGAAGCATAAATGGGTTCTCACATGTAATGTTTGCAACAGGACGAAAACCAAATACAAAGAATTTGGGTCTAGAAGAGGTTGGGGTCAAAATGGACAAGCATGGTGCTATTGTGGTTGATGAGTTCTCTCGAACCTCAGTTGATTCTATATGGGCTGTGGGTGATGTTACTAACAGGGTGAACTTGACACCGGTTGCATTAATGGAAGGTGGGGCATTAGCAAGGACTATTTTTGGCAATGAACCTACAAAACCAGATTACAGTGCTGTGCCATCTGCGGTGTTTTCCCAACCTCCAATTGGACAAGTTGGACTCACTGAAGAGAAGGCGATCGAAAAGTATGGAGATGTTGATGTCTACACATCAAACTTCAGACCTCTCAGGGCCACTCTTTCTGGTCTACCTGATCGTGTATACATGAAGGTTATCGTGTGTGCTAATACTAACAAAGTTCTAGGAGTGCACGTGTGTGGTGAAGATGCACCCGAGATTATTCAGGGTATTGCAATTGCTGTAAAGGCTGGGTTGATGAAGCAAAACTTTGATGCCACCATAGGTGTCCACCCAACCACTGCAGAAGAACTTGTCACAATGAGAAGCCCGACTAGGAAGGTCCGGAGAGATGCTGTGGATGAGGCCAAAATGAAAGATGAGGCCACAAGTCAGAAGTAG
Protein Sequence
  • >LOC_Os10g28000.1
    MTNKNLELQRLVGVQTNMLKNSGVTIIEGRGKVVDPHTVSVDGKLYTAKNILIAVGGRPSMPDIPGIEHVIDSDAALDLPSRPEKIAIVGGGYIALEFAGIFNGLKSGVHVFIRQKKVLRGFDEEVRDFVADQMSLRGITFHTEETPQAVMKSDDGLLTLTTNKGSINGFSHVMFATGRKPNTKNLGLEEVGVKMDKHGAIVVDEFSRTSVDSIWAVGDVTNRVNLTPVALMEGGALARTIFGNEPTKPDYSAVPSAVFSQPPIGQVGLTEEKAIEKYGDVDVYTSNFRPLRATLSGLPDRVYMKVIVCANTNKVLGVHVCGEDAPEIIQGIAIAVKAGLMKQNFDATIGVHPTTAEELVTMRSPTRKVRRDAVDEAKMKDEATSQK*