Gene Details:
- MSU gene ID: LOC_Os08g10630
- RAPdb gene ID: Os08g0207500
- Gene Symbol: OsZIP4
- Genome: MSU7 , IRGSP-1.0
- Species: Oryza sativa
Functional Descriptions:
- Furthermore, OsZIP4 transcripts were detected in the meristem of Zn-deficient roots and shoots.
- Transgenic rice plants overexpressing the OsZIP4 gene under the control of the cauliflower mosaic virus (CaMV) 35S promoter were produced.
- The Zn concentration in seeds of 35S-OsZIP4 plants was four times lower compared with vector controls.
- The Zn concentration in roots of 35S-OsZIP4 transgenic plants was 10 times higher than in those of vector controls, but it was five times lower in shoots.
- Northern blot analysis and quantitative real-time reverse transcription-PCR revealed transcripts of OsZIP4 expression driven by the CaMV 35S promoter in roots and shoots of 35S-OsZIP4 plants, but levels of endogenous OsZIP4 transcripts were low in roots and high in shoots compared with vector controls.
- Microarray analysis revealed that the genes expressed in shoots of 35S-OsZIP4 plants coincided with those induced in shoots of Zn-deficient plants.
- Microarray and northern blot analysis revealed that OsZIP4 was highly expressed under conditions of Zn deficiency in roots and shoots.
- Real-time-PCR revealed that the OsZIP4 transcripts were more abundant than those of OsZIP1 or OsZIP3 in Zn-deficient roots and shoots.
- In situ hybridization analysis revealed that OsZIP4 in Zn-deficient rice was expressed in shoots and roots, especially in phloem cells.
- Overexpression of the OsZIP4 zinc transporter confers disarrangement of zinc distribution in rice plants.
- OsZIP4 is a Zn transporter that localizes to apical cells.
- These results indicate that constitutive expression of OsZIP4 changes the Zn distribution within rice plants, and that OsZIP4 is a critical Zn transporter that must be strictly regulated.
- Four distinct genes, OsZIP4, OsZIP5, OsZIP6, and OsZIP7 that exhibit sequence similarity to the rice ferrous ion transporter, OsIRT1, were isolated.
- OsZIP4 complemented a Zn-uptake-deficient yeast (Saccharomyces cerevisiae) mutant, Deltazrt1,Deltazrt2, indicating that OsZIP4 is a functional transporter of Zn.
- These results suggested that OsZIP4 is a Zn transporter that may be responsible for the translocation of Zn within rice plants.
- OsZIP4, a novel zinc-regulated zinc transporter in rice.
- Immunostaining analysis revealed that OsZIP4 was mainly expressed in phloem of diffuse vascular bundles (DVBs) in the nodes and the axillary meristem.
- Mutation of OsZIP4 did not affect the total Zn uptake, but altered Zn distribution; less Zn was delivered to TB and new leaf, but more Zn was retained in the basal stems at the vegetative growth stage.
- At the reproductive stage, mutation of OsZIP4 resulted in delayed panicles development, which is associated with decreased Zn distribution to the panicles.
- Collectively, OsZIP4 is involved in transporting Zn to the phloem of DVBs in the nodes for subsequent distribution to TBs and other developing tissues.
Function-related keywords:
- meristem , flower , seed , shoot , root , zinc , transporter , vascular-bundle , growth , vegetative , reproductive , phloem , axillary-meristem , Zn-distribution
Literature:
- OsZIP4, a novel zinc-regulated zinc transporter in rice . DOI: 10.1093/jxb/eri317 ; PMID: 16263903
- Overexpression of the OsZIP4 zinc transporter confers disarrangement of zinc distribution in rice plants . DOI: 10.1093/jxb/erm147 ; PMID: 17630290
- A transporter for delivering zinc to the developing tiller bud and panicle in rice . DOI: 10.1111/tpj.15073 ; PMID: 33169459
- Comparative transcriptome profile analysis of rice varieties with different tolerance to zinc deficiency . DOI: 10.1111/plb.13227 ; PMID: 33296551
Related News:
Gene Resources:
- NCBI ID: AB126089
- UniProt accessions:
Sequences:
cDNA Sequence
- >LOC_Os08g10630.1
CCCCTCCTCCCCACACGCCACCCGCACGCGCGCCATGGACGCCATGAGGCAGAGCACGCCGCGGGCCATGCTGCTCCTGTGCGCCGTGCTGATGCTGGCCGTGGCGCCGCCGGGCGCGGCGACGGCGGCGGCGGTGGCCGGGTGCGAGTGCGGTAATGCGGCGGCGGCGGCGGTGGCGGGGGAGGACGCGCGCGGGGCGTTGCGGCTCAAGCTCGTCGCCATCGCGTCCATCCTGGCGGCGGGCGCGGCGGGGGTGCTGGTGCCCGTGCTGGGGAGGTCGTTCGCCGCGCTCCGGCCCGACGGCGACGTGTTCTTCGCCGTCAAGGCGTTCGCGGCGGGCGTCATCCTCGCCACCGGCATGGTGCACATCCTCCCCGCCGCGTTCGACGCGCTCGCTTCGCCGTGCGGCGGAGGCAGGGGCGGCGGAGGCGGGTTCCCGTTCGCCGGGCTCGTCGCCATGGCCGCGGCCATGGCCACCATGATGATCGACTCCGTCGCCGCCGGGTACTACCGCCGGTCCCACTTCAAGAAGCCGCGCCCCGTCGACGACCCCGCCGACGCCGCGCGCGCCGCCGGGGTCGAGGAGGGCGGCGCCGAGCACGCCGGCCACGTCCACGTGCACACGCACGCCACGCACGGCCACGCCCATGGCCACGTGCACTCGCACGGCCACGGCCACGGCCACAGCCACGGCAGCGCGCCGGCGGCCGCCACCTCGCCGGAGGATGCCTCCGTCGCCGAAACAATCCGGCACAGGGTTGTCTCCCAGGTTCTGGAGCTGGGAATCCTGGTGCACTCGGTGATCATCGGGGTTTCGCTAGGCGCATCACTGAGGCCGTCGTCAATCAGGCCACTCGTCGGAGCCCTCAGCTTCCACCAGTTCTTTGAAGGCATTGGCCTTGGTGGCTGCATTGTTCAGGCAAATTTTAAGGCGAAAGCAACAGTGATCATGGCGACTTTCTTCTCCCTCACTGCTCCGGTGGGCATTGCACTGGGGATCGCAATCTCATCCAGCTATAGCAAGCACAGCTCGACCGCACTTGTCGTCGAGGGAGTCTTCAACTCTGCTGCAGCAGGGATACTGATCTACATGTCCCTGGTCGATCTCCTCGCTGCAGATTTCAACAATCCGAAGCTTCAAACAAACACAAAGCTTCAGCTGGCAGTATACCTCGCCCTCTTCCTCGGCGCTGGGATGATGTCTCTGCTTGCCATATGGGCATGAGATCTTCAGAGCAACCAAGAGCTGCAAATTTTTGAATATTGTCTCTGAAAAAGACACCCTGAGCTTAGTTTGTAGCTGACAGGGTTTGATGTTGTCATAGCATTACTGCAACCAGCTTTTGTAGAATCTCCATCAACCAGAATTGGAGAAAAAGATGGCCTGAATACGACCGAAAGTTTAGAGTTTACTGACATGAGTACACAAGTCAAAAGTTCAGGACAAATCTGATTCTTGGGCAAATGGTGTGCTTCCACCAGTATAGCACCAAATGAAGTGAACAAGAATCAAATGGGTTAGTCGAGGTAGTGGTCCTTGAACAGATTTTCTCTTCAAGTCCAAAAGCTTTGTATAAAAATGATGACCTCCTTTTGGAGTCAATGTCAATGTACAGATTCTCAGCTAGGGTAAATCCTTTTTGTATGACAAGAGCTCTGTGAAGTTTGTTCACTTGTTCAGTGAAGAATCAAATAATCCCCAGCGTTGTCTCCTTTTTCTCTA
CDS Sequence
- >LOC_Os08g10630.1
ATGGACGCCATGAGGCAGAGCACGCCGCGGGCCATGCTGCTCCTGTGCGCCGTGCTGATGCTGGCCGTGGCGCCGCCGGGCGCGGCGACGGCGGCGGCGGTGGCCGGGTGCGAGTGCGGTAATGCGGCGGCGGCGGCGGTGGCGGGGGAGGACGCGCGCGGGGCGTTGCGGCTCAAGCTCGTCGCCATCGCGTCCATCCTGGCGGCGGGCGCGGCGGGGGTGCTGGTGCCCGTGCTGGGGAGGTCGTTCGCCGCGCTCCGGCCCGACGGCGACGTGTTCTTCGCCGTCAAGGCGTTCGCGGCGGGCGTCATCCTCGCCACCGGCATGGTGCACATCCTCCCCGCCGCGTTCGACGCGCTCGCTTCGCCGTGCGGCGGAGGCAGGGGCGGCGGAGGCGGGTTCCCGTTCGCCGGGCTCGTCGCCATGGCCGCGGCCATGGCCACCATGATGATCGACTCCGTCGCCGCCGGGTACTACCGCCGGTCCCACTTCAAGAAGCCGCGCCCCGTCGACGACCCCGCCGACGCCGCGCGCGCCGCCGGGGTCGAGGAGGGCGGCGCCGAGCACGCCGGCCACGTCCACGTGCACACGCACGCCACGCACGGCCACGCCCATGGCCACGTGCACTCGCACGGCCACGGCCACGGCCACAGCCACGGCAGCGCGCCGGCGGCCGCCACCTCGCCGGAGGATGCCTCCGTCGCCGAAACAATCCGGCACAGGGTTGTCTCCCAGGTTCTGGAGCTGGGAATCCTGGTGCACTCGGTGATCATCGGGGTTTCGCTAGGCGCATCACTGAGGCCGTCGTCAATCAGGCCACTCGTCGGAGCCCTCAGCTTCCACCAGTTCTTTGAAGGCATTGGCCTTGGTGGCTGCATTGTTCAGGCAAATTTTAAGGCGAAAGCAACAGTGATCATGGCGACTTTCTTCTCCCTCACTGCTCCGGTGGGCATTGCACTGGGGATCGCAATCTCATCCAGCTATAGCAAGCACAGCTCGACCGCACTTGTCGTCGAGGGAGTCTTCAACTCTGCTGCAGCAGGGATACTGATCTACATGTCCCTGGTCGATCTCCTCGCTGCAGATTTCAACAATCCGAAGCTTCAAACAAACACAAAGCTTCAGCTGGCAGTATACCTCGCCCTCTTCCTCGGCGCTGGGATGATGTCTCTGCTTGCCATATGGGCATGA
Protein Sequence
- >LOC_Os08g10630.1
MDAMRQSTPRAMLLLCAVLMLAVAPPGAATAAAVAGCECGNAAAAAVAGEDARGALRLKLVAIASILAAGAAGVLVPVLGRSFAALRPDGDVFFAVKAFAAGVILATGMVHILPAAFDALASPCGGGRGGGGGFPFAGLVAMAAAMATMMIDSVAAGYYRRSHFKKPRPVDDPADAARAAGVEEGGAEHAGHVHVHTHATHGHAHGHVHSHGHGHGHSHGSAPAAATSPEDASVAETIRHRVVSQVLELGILVHSVIIGVSLGASLRPSSIRPLVGALSFHQFFEGIGLGGCIVQANFKAKATVIMATFFSLTAPVGIALGIAISSSYSKHSSTALVVEGVFNSAAAGILIYMSLVDLLAADFNNPKLQTNTKLQLAVYLALFLGAGMMSLLAIWA*