WOX11

Gene Details

MSU gene ID: LOC_Os07g48560
RAPdb gene ID: Os07g0684900
Gene Symbol: WOX11
Genome: MSU7 , IRGSP-1.0
Species: Oryza sativa

Functional Descriptions

The WUSCHEL-related homeobox gene WOX11 is required to activate shoot-borne crown root development in rice.
Quantitative polymerase chain reaction (PCR) results showed that expression levels of WUSCHEL-related Homeobox (WOX) gene, WOX11, and some flowering regulators were promoted in the OsMADS15 overexpression transgenic plants, indicating that OsMADS15 had a wide range of regulations.
In this work, we show that a WUSCHEL-related Homeobox (WOX) gene, WOX11, is involved in the activation of crown root emergence and growth.
The expressions of auxin- and cytokinin-responsive genes were affected in WOX11 overexpression and RNA interference transgenic plants.
The results suggest that WOX11 may be an integrator of auxin and cytokinin signaling that feeds into RR2 to regulate cell proliferation during crown root development.
WOX11 was found to be expressed in emerging crown roots and later in cell division regions of the root meristem.
Further analysis showed that WOX11 directly repressed RR2, a type-A cytokinin-responsive regulator gene that was found to be expressed in crown root primordia.
Here, we report that ectopic expression of WOX11 gene driven by the promoter of OsHAK16 encoding a low-K-enhanced K transporter led to an extensive root system and adventitious roots and more effective tiller numbers in rice.
The results suggest that enlarging root growth and development by the expression of WOX11 in roots could provide a useful option for increasing K acquisition efficiency and cereal crop productivity in low K soil.
The Interaction between Rice ERF3 and WOX11 Promotes Crown Root Development by Regulating Gene Expression Involved in Cytokinin Signaling.
However, the nature of WOX11 function in crown root development has remained elusive.
Here, we identified a rice AP2/ERF protein, ERF3, which interacts with WOX11 and was expressed in crown root initials and during crown root growth.
Downregulation of ERF3 in WOX11 mutants produced a more severe root phenotype.
The expression of ERF3 and WOX11 only partially overlapped, underlining a spatio-temporal control of RR2 expression and crown root development.
WUSCHEL-related homeobox gene WOX11 increases rice drought resistance by controlling root hair formation and root system development.
In this study, we further analyzed the root phenotypes of WOX11 transgenic plants and revealed that WOX11 also actes in controlling root hair development and enhancing rice drought resistance, in addition to its roles in regulating crown root and lateral root development.
Based on this new finding, we proposed the mechanism of that WOX11 is involved in drought resistance by modulating rice root system development.
Rice Homeodomain Protein WOX11 Recruits a Histone Acetyltransferase Complex to Establish Programs of Cell Proliferation of Crown Root Meristem.
Previous work has shown that the Wuschel-related homeobox gene WOX11 is necessary and sufficient to promote rice (Oryza sativa) crown root emergence and elongation.
Here, we show that WOX11 recruits the ADA2-GCN5 histone acetyltransferase (HAT) module to activate downstream target genes in crown root meristem.
WOX11 and ADA2-GCN5 commonly target and regulate a set of root-specific genes involved in energy metabolism, cell wall biosynthesis, and hormone response, some of which are known to be important for root development.
The results indicate that the recruitment of ADA2-GCN5 by WOX11 establishes gene expression programs of crown root meristem cell division and suggest that permissive chromatin modification involving histone acetylation is a strategy for WOX11 to stimulate root meristem development.
Transcriptional regulatory network of WOX11 is involved in the control of crown root development, cytokinin signals, and redox in rice.
In addition to specifically activating crown root development, WOX11 is also involved in lateral root initiation, root hair formation, and abiotic stresses.
Here, we studied the transcriptome of WOX11 root tips by RNA-Seq and determined direct WOX11-binding targets by bioinformatic and biochemical analysis.
The analysis identified several genes that acted downstream of WOX11 in controlling crown root formation, cytokinin signaling, stress response, and redox metabolism.
This work built a hierarchical regulatory model of WOX11 in rice crown root development.
The results suggest that recruitment of JMJ705 to specific developmental pathway genes is promoted by DNA-binding transcription factors and that WOX11 functions to stimulate shoot growth through epigenetic reprogramming of genes involved in meristem development and energy-generating pathways.
Genetic analysis indicates that WOX11 and JMJ705 cooperatively control shoot growth and commonly regulate the expression of a set of genes involved in meristem identity, chloroplast biogenesis, and energy metabolism in the shoot apex.
WOX11 recruits a histone H3K27me3 demethylase to promote gene expression during shoot development in rice.
Here, we show that WOX11 interacts with the H3K27me3 demethylase JMJ705 to activate gene expression during shoot development in rice.
We find that YUC overexpression-induced crown root proliferation requires the presence of the transcription factor WOX11.
Auxin activates WOX11 transcription, which subsequently drives crown root initiation and development, establishing the YUC-Auxin-WOX11 module for crown root development in rice.
Moreover, the crown rootless phenotype of taa1 mutants was partially rescued by overexpression of WOX11.
A Non-canonical MITE in WOX11 Promoter is Associated With Robust Crown Root in Rice.
As an important regulator of rice crown root development, WOX11 is essential for crown root formation and its transcript level is positively correlated with crown roots biomass.
However, how WOX11 is regulated during crown root primordium emergence and outgrowth still remains unknown.
Furthermore, pWOX11(ncMITE+):WOX11-FLAG in WOX11 background could complement crown root number and length compared to those of wild type (WT), while pWOX11(ncMITE-):WOX11-FLAG could not.
This work provides novel insight into WOX11 expression regulation and reveals a promising target for genetic improvement of root architecture in rice.
Analysis of WOX11 promoter driven reporter gene GUS (β-glucuronidase) transgenic plants pWOX11(ncMITE+):GUS and pWOX11(ncMITE-):GUS uncovered higher GUS expression level in crown roots of pWOX11(ncMITE+):GUS plants.
These results suggested that the ncMITE was positively associated WOX11 transcripts in rice crown roots.
RESULTS: We demonstrated that WOX11 was required to maintain ROS homeostasis by upregulating peroxidase genes in the crown root meristem.
Finally, acetylproteomic analysis of wild type and WOX11 roots treated with or without potassium iodide (KI) and hydrogen peroxide (H(2)O(2)) was used to study the effects of ROS on protein acetylation in rice CR cells.
WOX11 and CRL1 act synergistically to promote crown root development by maintaining cytokinin homeostasis in rice.
Eletrophoretic mobility shift assays (EMSAs), transient expression and chromatin immunoprecipitation qPCR (ChIP-qPCR) suggested that WOX11 and CRL1 directly bind to OsCKX4 to regulate its expression during crown root development.
CRL1 enhances OsCKX4 activation through direct interaction with WOX11 at root emergence and elongation stages.
Increased expression of OsCKX4 could partially complement the crown root phenotypes of both crl1 and WOX11 mutants.
Furthermore, cytokinin can promote WOX11 protein accumulation in root meristem.
Importantly, these results reveal an intrinsic link between WOX11 protein accumulation and cytokinin to maintain crown root growth.
Transcription factor WOX11 regulates protein translation via ribosome protein acetylation in rice roots.

Functional Keywords

Literature and News

Gene Resources

Sequences

cDNA Sequence

>LOC_Os07g48560.1
AAGCCAATTAAGCGAATTAAGCACACATCAATTGACCAAACCTATCTCTCTATCTCTCTCGAGCTAGCGAGCTCTAGGTGTTCGACACCGAACAAGGCAGCTAGCTAGTGGCGATGGACGGCGGCCACAGCCCGGACAGGCATGCGGCGGCGGCGGCGGGGGAGCCGGTGAGGTCGCGGTGGACGCCGAAGCCGGAGCAGATACTCATCCTGGAGTCCATCTTCAACAGCGGCATGGTGAACCCGCCCAAGGACGAGACCGTCCGCATCCGCAAGCTGCTCGAGCGCTTCGGCGCCGTCGGCGACGCCAACGTCTTCTACTGGTTCCAGAACCGCCGCTCGCGCTCCCGCCGCCGCCAGCGCCAGCTGCAGGCGCAGGCGCAGGCGGCCGCGGCCGCCGCCTCGTCGGGATCTCCTCCGACTGCTTCGTCCGGTGGCCTCGCGCCTGGCCACGCCGGCTCGCCGGCTTCGTCGCTCGGGATGTTCGCGCACGGCGCCGCCGGGTACAGCTCCTCGTCGTCCTCATCGTGGCCGTCCTCGCCGCCGTCGGTGGGGATGATGATGGGGGACGTGGACTACGGGGGCGGCGGCGACGACCTGTTCGCCATCTCGAGGCAGATGGGGTACATGGACGGCGGCGGCGGCTCGTCGTCGTCGGCGGCCGCCGGTCAGCATCAGCAGCAGCAGCTCTACTACTCGTGTCAACCTGCGACGATGACGGTGTTCATCAACGGAGTGGCGACGGAGGTGCCAAGGGGACCGATCGATCTGAGATCAATGTTTGGGCAGGACGTGATGCTGGTGCATTCAACGGGTGCTCTTCTTCCAGCCAACGAGTACGGCATCCTCCTCCATTCTCTCCAGATGGGCGAGAGCTACTTCCTGGTCACGAGGTCGTCTTGATCGAGTTGAGCGATTCGTCGATTGATTGATCGATGGCAACGTACGTATTGTGTCAGCAAGATTTAGGTACCCCTTGTCCGTTGGATCAGATCGATATGCAAGCAACGCATGCTTTGCAGGTGCCGGCCGGTTAATTACGCGATCGATCGAGCTAGCAGATGATGAATGCTGCACGTACGCATGGCAATTGTCACTGCGACGAGCCTGCATATATATGAACGATCCATTGATCGTCATTCTAGCGACCAAGCAGCACGATAGTACAAGTATATACTATACAATGCAATTGCAGCGACGAACTAGTTAATTATAATACAGATAATGCATGTGTACTTCTGTGGCCATACATATATATATAGAGAGAGAGGGGATTAATTACTATATTCGTTTTTCATCTAGCTGGTCGATCTCTGTGTGTACTTGTATGTATCCCGTTCTCGATCTTTATATCAGAATATTTTATATATGTATATTTTACAATTATATATATAGCCGTCTCGATCGCCAAGCAAATTAA

CDS Sequence

>LOC_Os07g48560.1
ATGGACGGCGGCCACAGCCCGGACAGGCATGCGGCGGCGGCGGCGGGGGAGCCGGTGAGGTCGCGGTGGACGCCGAAGCCGGAGCAGATACTCATCCTGGAGTCCATCTTCAACAGCGGCATGGTGAACCCGCCCAAGGACGAGACCGTCCGCATCCGCAAGCTGCTCGAGCGCTTCGGCGCCGTCGGCGACGCCAACGTCTTCTACTGGTTCCAGAACCGCCGCTCGCGCTCCCGCCGCCGCCAGCGCCAGCTGCAGGCGCAGGCGCAGGCGGCCGCGGCCGCCGCCTCGTCGGGATCTCCTCCGACTGCTTCGTCCGGTGGCCTCGCGCCTGGCCACGCCGGCTCGCCGGCTTCGTCGCTCGGGATGTTCGCGCACGGCGCCGCCGGGTACAGCTCCTCGTCGTCCTCATCGTGGCCGTCCTCGCCGCCGTCGGTGGGGATGATGATGGGGGACGTGGACTACGGGGGCGGCGGCGACGACCTGTTCGCCATCTCGAGGCAGATGGGGTACATGGACGGCGGCGGCGGCTCGTCGTCGTCGGCGGCCGCCGGTCAGCATCAGCAGCAGCAGCTCTACTACTCGTGTCAACCTGCGACGATGACGGTGTTCATCAACGGAGTGGCGACGGAGGTGCCAAGGGGACCGATCGATCTGAGATCAATGTTTGGGCAGGACGTGATGCTGGTGCATTCAACGGGTGCTCTTCTTCCAGCCAACGAGTACGGCATCCTCCTCCATTCTCTCCAGATGGGCGAGAGCTACTTCCTGGTCACGAGGTCGTCTTGA

Protein Sequence

>LOC_Os07g48560.1
MDGGHSPDRHAAAAAGEPVRSRWTPKPEQILILESIFNSGMVNPPKDETVRIRKLLERFGAVGDANVFYWFQNRRSRSRRRQRQLQAQAQAAAAAASSGSPPTASSGGLAPGHAGSPASSLGMFAHGAAGYSSSSSSSWPSSPPSVGMMMGDVDYGGGGDDLFAISRQMGYMDGGGGSSSSAAAGQHQQQQLYYSCQPATMTVFINGVATEVPRGPIDLRSMFGQDVMLVHSTGALLPANEYGILLHSLQMGESYFLVTRSS*