FZP;BFL1

Gene Details

MSU gene ID: LOC_Os07g47330
RAPdb gene ID: Os07g0669500
Gene Symbol: FZP BFL1 SGDP7 PAA7
Genome: MSU7 , IRGSP-1.0
Species: Oryza sativa

Functional Descriptions

The spikelet identity gene FZP’’ (frizzy panicle) is required for transformation of the floral meristems to inflorescent shoots.
In FZP mutants, spikelets are replaced by branches and spikelet meristems produce massive numbers of branch meristems.
Many FZP mutants drastically alter panicle morphology with higher-order rachis-branches developing successively instead of the development of floral organs in these mutants.
In addition, the AP2 family genes are important for determining the degree of ramification in branch meristems, regulating the spatio-temporal expression of spikelet meristem genes, such as FRIZZY PANICLE (FZP).
In the frizzy panicle (FZP) mutant of rice, the formation of florets is replaced by sequential rounds of branching.
The sequence analysis of FZP-9(t) revealed that there is a single nucleotide base change upstream of the ERF (ethylene-responsive element-binding factor) domain compare to wild-type plant.
Morphological and molecular characterization of a new frizzy panicle mutant, FZP-9(t), in rice (Oryza sativa L.).
The rice FRIZZY PANICLE (FZP) locus on chromosome 7, in which an ERF and acidic domain are present, is concerned with the regulation of spikelet meristem identity and the determination of panicle architecture.
The FZP mutant phenotype suggests that FZP is required to prevent the formation of axillary meristems within the spikelet meristem and permit the subsequent establishment of floral meristem identity.
A new mutant showing the same FZP phenotype was induced by γ-ray irradiation of seeds of a rice cultivar “Gimbozu.
In each of the normal panicle-bearing progeny plants, from occasional revertant seeds of the vegetatively-propagated mutant plant, Ds was shown to be excised from the BFL1 locus.
Using a two-element Ac/Ds transposon tagging system we have isolated a rice mutant, designated branched floretless 1 (BFL1) which is defective in the transition from spikelet meristem to floret meristem.
RESULTS: The BFL1 mutant shows normal differentiation of the primary rachis-branches leading to initial spikelet meristem (bract-like structure equivalent to rudimentary glumes) formation but fails to develop empty glumes and florets.
CONCLUSIONS: BFL1 is a Ds-tagged rice mutant defective in the transition from spikelet meristem (SM) to floret meristem (FM).
BFL1 contains an EREBP/AP2 domain and is most likely an ortholog of the maize transcription factor gene BRANCHED SILKLESS1 (BD1).
BFL1 is most probably a rice ortholog of the maize ERF (EREBP/AP2) transcription factor gene BD1.
FZP-10 has several new characteristics, its altered nucleotide position and severity of phenotype alteration, and, therefore, could be a new gene resource to examine the function of FZP and the determination of rice panicle architecture.
A novel frameshift mutant allele, FZP-10, affecting the panicle architecture of rice.
Examination of this FZP-like mutant for its allelism to a known allele of FZP-1, nucleotide sequence, and panicle and agronomic characteristics clearly indicated that the allele of this FZP-like mutant is located in FZP.
The degree of higher-order branching in the panicles was significantly reduced in the FZP-10 mutant compared with that of FZP-1.
Moreover, the FZP-10 mutant showed highly depressed culm and panicle lengths and panicle number, as well as delayed heading dates compared with its wild type and also with FZP-1.
FZP encodes an ERF transcription factor and is the rice ortholog of the maize BD1 gene.
The FZP-9 (t) mutant showed retarded growth habit and developed fewer tillers than those of the wild- type plant.
We have isolated and characterized a new FZP mutant derived from anther culture lines in rice and designated as FZP-9 (t).
Based on the similarities in mutant phenotypes BFL1 is likely to be an allele of the previously reported frizzy panicle locus.
Ds tagging of BRANCHED FLORETLESS 1 (BFL1) that mediates the transition from spikelet to floret meristem in rice (Oryza sativa L).
The primary and secondary rachis branches of FZP-9 (t) appeared to be normal, but higher-order branches formed continuous bract- like structures without developing spikelets.
Regulatory role of FZP in the determination of panicle branching and spikelet formation in rice.
However, the relationships among FZP and these floral identity genes in the regulation of panicle formation remain unclear.
The results indicate that FZP is a major negative regulator of RFL/APO2 and determines the transition from panicle branching to spikelet formation.
Moreover, overexpression of FZP severely represses axillary meristem formation in both the vegetative and reproductive phases and the outgrowth of secondary branches in panicle.
FZP overexpression positively regulates the expression of a subset of the class B genes, AGL6 genes (OsMADS6 and OsMADS17) as well as class E genes (OsMADS1, OsMADS7 and OsMADS8) in floral meristem (FM).
Thus, it suggested that FZP could specify floral organ identity by regulating the related OsMADS-box genes.
The CNV-18bp duplication repressed FZP expression, prolonged the panicle branching period and increased grain yield by more than 15% through substantially increasing the number of spikelets per panicle (SPP) and slightly decreasing the 1,000-grain weight (TGW).
Duplication of an upstream silencer of FZP increases grain yield in rice.
These findings showed that the silencer CNVs coordinate a trade-off between SPP and TGW by fine-tuning FZP expression, and balancing the trade-off could enhance yield potential.
SGDP7 is identical to FZP (FRIZZY PANICLE), which represses the formation of axillary meristems.
FZP determines grain size and sterile lemma fate in rice.
In the study, FZP encodes an ERF domain protein, and functions in grain size and sterile lemma identity.
Our results revealed that FZP plays a vital role in the regulation of grain size, and first provides clear evidence in support of the hypothesis that the lemma, rudimentary glume, and sterile lemma are homologous organs.
Interestingly, the sterile lemma underwent a homeotic transformation into a rudimentary glume in the FZP-12 and FZP-13 mutants, whereas the sterile lemma underwent a homeotic transformation into a lemma in FZP over-expressing plants, suggesting that FZP specifically determines the sterile lemma identity.
Mutation of FZP causes smaller grains and degenerated sterile lemmas.
Functional analyses showed that NARROW LEAF 1 (NAL1), a trypsin-like serine and cysteine protease, interacted with FZP and promoted FZP degradation.
Variation in FZP regulatory region causes increases of inflorescence secondary branches and grain yield in rice domestication.
7-kb upstream of FZP may affect the binding activities of Auxin Response Factors (OsARFs) to the FZP promoter, decrease FZP expression level, and significantly enhance secondary branch number and grain yields in cultivated rice.
Consistently, down-regulating FZP expression or up-regulating NAL1 expression in commercial cultivar Zhonghua 17 increased secondary branches per panicle, grain number per panicle, and grain yield per plant.
Reduced expression of FZP in the reproductive stage increases the extent of higher order branching of the panicle, resulting in increased grain number.
These findings suggest that PAA7 regulates the development of apical spikelets and interacts with LAX2 to regulate panicle development in rice.
Moreover, the severe damage for panicle phenotype in PAA7/lax2 double mutant indicated that PAA7 could crosstalk with Lax Panicle 2 (LAX2).
Map-based cloning revealed that the 3 bp "AGC" insertion and 4 bp "TCTC" deletion mutation of PAA7 were located in the 3'-UTR regions of LOC_Os07g47330, which was confirmed through complementary assays and overexpressed lines.
High accumulations of H(2)O(2) in PAA7 caused programmed cell death (PCD) accompanied by nuclear DNA fragmentation in the apical spikelets.

Functional Keywords

Literature and News

Gene Resources

Sequences

cDNA Sequence

>LOC_Os07g47330.1
ACACACAAGCTAAGCTTAGCTCGAGCTCATTCATATACCTTAGCTTAGCTAAAGCCTAGCTCACTCTCACTCTCACTCTTGCATTGCATTGCAATATTGCAATATTGCATTGGTCATGAACACTCGAGGCAGCGGCAGTAGCAGCAGCAGCAGCAGCAGCCAGGCCAGCCTGATGGCGTTCTCGGAGCCGCCGAAGCCGGCGAGCCAGCCGTCGCCGCCGTCGTCGCCGATGAGCGAGCGGCCGCCGTCGGGGCGCAGCAGGCGGCGCGCGCAGGAGCCAGGGAGGTTCCTCGGCGTGCGGCGGCGGCCGTGGGGGAGGTACGCTGCCGAGATACGCGACCCGACCACCAAGGAGCGGCACTGGCTGGGCACGTTCGACACGGCGCAGGAGGCGGCGCTGGCGTACGACCGCGCCGCGCTGTCCATGAAGGGCGCCCAGGCGCGCACCAACTTCGTCTACACCCACGCCGCCTACAACTACCCGCCGTTCCTCGCGCCGTTCCACGCGCCGCAGTACGCCGCTGCCGCCGCCGCGCCGTCCTCGGTGCAGTACGGCGGCGGCGTGGGCGCGGCGCCGCACATTGGCTCGTACGGTCACCACCACCACCACCACCACCACCACGGACATGGCGCGGCGTCGGGCGCGTCGTCGGTGGGCGAGTGCTCGACGATGCCGGTGATGGTCCCGGTTGATCCCCACCGCTCCAGCATGTCGTCGTCGCTGCTGGACATGGACAGGAACGGCCACGACTTCCTCTTCTCCGGCGCCGACGACAACTCCGGGTACCTGAGCAGCGTGGTGCCGGAGAGCTGCCTCCGGCCGAGGGGCGGCGGCGCCGCGGCCGATCATCAGGACATGCGGCGCTACTCCGACGCCGACGCCTACGGCATGATGGGGCTCCGGGAGGACGTCGACGACCTCGCGCAGATGGTCGCCGGCTTCTGGGGCGGCGGCGACGCGGCGGACCAGCTCGGCGCCTGCGGGTTCCCGGCGAGCGGCGGCGCCGCCGACATGGTCGCCTCGTCGCAGGGCTCCGACTCCTACTCTCCATTCAGCTTCCTCTCCCATTGATCGAGTTGCACCGGGCATTGCATGGCTAATCACGCACTTTGCCTCTGAGCGATCATGCATATATCATTTCCTGTCTACCATGATCAGATCGAGTTGATCTTGATCAATCTGCGTTTGATCGATCGAGCAAGAGATCGAGTAGTATAGCAGCAGCAGCAGCAGCAGCTAGCAGTAGATCGAACAAGAAGAGTGGCTTGGCGCCATTTCTAGTTAATTAAGTAGAGCTTCTTCAAATATGTACTTAGGCAGATGATCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTTCTATATTAGCATTAGTACCTACTTAGCCATCATATTCATGCATGCATGCATGATATATTGCATGGCACAGCTTGTTAATTTCTTCTAGCATCTTAATCAATTAATCCATGACCTGGTTCAAAATGTCCAA

CDS Sequence

>LOC_Os07g47330.1
ATGAACACTCGAGGCAGCGGCAGTAGCAGCAGCAGCAGCAGCAGCCAGGCCAGCCTGATGGCGTTCTCGGAGCCGCCGAAGCCGGCGAGCCAGCCGTCGCCGCCGTCGTCGCCGATGAGCGAGCGGCCGCCGTCGGGGCGCAGCAGGCGGCGCGCGCAGGAGCCAGGGAGGTTCCTCGGCGTGCGGCGGCGGCCGTGGGGGAGGTACGCTGCCGAGATACGCGACCCGACCACCAAGGAGCGGCACTGGCTGGGCACGTTCGACACGGCGCAGGAGGCGGCGCTGGCGTACGACCGCGCCGCGCTGTCCATGAAGGGCGCCCAGGCGCGCACCAACTTCGTCTACACCCACGCCGCCTACAACTACCCGCCGTTCCTCGCGCCGTTCCACGCGCCGCAGTACGCCGCTGCCGCCGCCGCGCCGTCCTCGGTGCAGTACGGCGGCGGCGTGGGCGCGGCGCCGCACATTGGCTCGTACGGTCACCACCACCACCACCACCACCACCACGGACATGGCGCGGCGTCGGGCGCGTCGTCGGTGGGCGAGTGCTCGACGATGCCGGTGATGGTCCCGGTTGATCCCCACCGCTCCAGCATGTCGTCGTCGCTGCTGGACATGGACAGGAACGGCCACGACTTCCTCTTCTCCGGCGCCGACGACAACTCCGGGTACCTGAGCAGCGTGGTGCCGGAGAGCTGCCTCCGGCCGAGGGGCGGCGGCGCCGCGGCCGATCATCAGGACATGCGGCGCTACTCCGACGCCGACGCCTACGGCATGATGGGGCTCCGGGAGGACGTCGACGACCTCGCGCAGATGGTCGCCGGCTTCTGGGGCGGCGGCGACGCGGCGGACCAGCTCGGCGCCTGCGGGTTCCCGGCGAGCGGCGGCGCCGCCGACATGGTCGCCTCGTCGCAGGGCTCCGACTCCTACTCTCCATTCAGCTTCCTCTCCCATTGA

Protein Sequence

>LOC_Os07g47330.1
MNTRGSGSSSSSSSSQASLMAFSEPPKPASQPSPPSSPMSERPPSGRSRRRAQEPGRFLGVRRRPWGRYAAEIRDPTTKERHWLGTFDTAQEAALAYDRAALSMKGAQARTNFVYTHAAYNYPPFLAPFHAPQYAAAAAAPSSVQYGGGVGAAPHIGSYGHHHHHHHHHGHGAASGASSVGECSTMPVMVPVDPHRSSMSSSLLDMDRNGHDFLFSGADDNSGYLSSVVPESCLRPRGGGAAADHQDMRRYSDADAYGMMGLREDVDDLAQMVAGFWGGGDAADQLGACGFPASGGAADMVASSQGSDSYSPFSFLSH*