Ghd7

Gene Details

MSU gene ID: LOC_Os07g15770
RAPdb gene ID: Os07g0261200
Gene Symbol: Ghd7
Genome: MSU7 , IRGSP-1.0
Species: Oryza sativa

Functional Descriptions

Here we show that the quantitative trait locus (QTL) Ghd7, isolated from an elite rice hybrid and encoding a CCT domain protein, has major effects on an array of traits in rice, including number of grains per panicle, plant height and heading date.
Enhanced expression of Ghd7 under long-day conditions delays heading and increases plant height and panicle size.
Moreover, OsELF3-1 suppresses a flowering repressor grain number, plant height and heading date 7 (Ghd7) to indirectly accelerate flowering under long-day (LD) conditions.
Ehd1 and Hd3a can also be down-regulated by the photoperiodic flowering genes Ghd7 and Hd1 (a rice ortholog of CONSTANS).
By using near-isogenic lines with functional or deficient alleles of several rice flowering-time genes, we observed significant digenetic interactions between Hd16 and four other flowering-time genes (Ghd7, Hd1, DTH8 and Hd2).
These results demonstrate that Hd16 acts as an inhibitor in the rice flowering pathway by enhancing the photoperiod response as a result of the phosphorylation of Ghd7.
Our results demonstrate that natural variation in Hd17 may change the transcription level of a flowering repressor, Grain number, plant height and heading date 7 (Ghd7), suggesting that Hd17 is part of rice’s photoperiodic flowering pathway.
On the other hand, under long-day (LD) conditions, flowering is delayed by the repressive function of Hd1 on FT-like genes and by downregulation of Ehd1 by the flowering repressor Ghd7 - a unique pathway in rice.
Furthermore, Ehd3 Ghd7 plants flowered earlier and show higher Ehd1 transcript levels than ehd3 Ghd7 plants, suggesting a Ghd7-independent role of Ehd3 in the upregulation of Ehd1.
We propose that both positive (OsMADS50 and Ehd1) and negative (Hd1, phyB and Ghd7) regulators of RFT1 form a gene network that regulates LD flowering in rice.
Ghd7 (Grain number, plant height and heading date 7) was acutely induced when phytochrome signals coincided with a photosensitive phase set differently by distinct photoperiods and this induction repressed Ehd1 the next morning.
However, the Grain number, plant height, and heading date7 (Ghd7) pathway was altered in ostrx1.
Increased transcription of Ghd7 under LD conditions and reduced transcription of downstream Ehd1 and FT-like genes in the ehd3 mutants suggested that Ehd3 normally functions as an LD downregulator of Ghd7 in floral induction.
rufipogon) was used to analyze the evolution and association of Ghd7 with plant height, heading date, and yield.
Meanwhile, the transcription of DTH8 has been proved to be independent of Ghd7 and Hd1, and the natural mutation of this gene caused weak photoperiod sensitivity and shorter plant height.
Analyses using a rice phytochrome chromophore-deficient mutant, photoperiod sensitivity5, have so far revealed that within this network, phytochromes are required for expression of Grain number, plant height and heading date7 (Ghd7), a floral repressor gene in rice.
Similarly, in the homozygous Koshihikari genetic background at Ghd7, the difference in heading date caused by different alleles at Hd2 was smaller than in plants homozygous for the Hayamasari Ghd7 allele.
In addition, QTLs near Hd2, Hd16, and Ghd7, which are involved in inhibition of heading under long-day conditions, function in the same pathway that controls heading date.
SNP changes between haplotypes indicated that Ghd7 evolved from two distinct ancestral gene pools, and independent domestication processes were detected in indica and japonica varietals respectively.
Thus, two distinct gating mechanisms–of the floral promoter Ehd1 and the floral repressor Ghd7–could enable manipulation of slight differences in day length to control Hd3a transcription with a critical day-length threshold.
Transcript levels of OsGI, phytochrome genes, and Early heading date3 (Ehd3), which function upstream of Ghd7, were unchanged in the mutant.
Moreover, phyB and phyA can affect Ghd7 activity and Early heading date1 (a floral inducer) activity in the network, respectively.
These associations provide the potential for flexibility of Ghd7 application in rice breeding programs.
Notably, the japonica varieties harboring nonfunctional alleles of both Ghd7/Hd4 and PRR37/Hd2 flower extremely early under natural long-day conditions, and are adapted to the northernmost regions of rice cultivation, up to 53 degrees N latitude.
Genetic analysis revealed that the effects of PRR37 and Ghd7 alleles on heading date are additive, and PRR37 down-regulates Hd3a expression to suppress flowering under long-day conditions.
Thus, Ghd7 has played crucial roles for increasing productivity and adaptability of rice globally.
Natural variation in Ghd7 is an important regulator of heading date and yield potential in rice.
The enhanced expression of Ghd7 decreased chlorophyll content, mainly through down-regulating the expression of genes involved in the biosynthesis of chlorophyll and chloroplast.
We employed a map-based cloning approach to isolate a heading date gene, which coordinated the interaction between Ghd7 and Ghd8 to greatly delay rice heading.
Map-based cloning demonstrated that the gene largely affecting the interaction between Ghd7 and Ghd8 was Hd1.
Here, we report biological interactions between Ghd7 and Hd1, which together repress Early heading date 1 (Ehd1), a key floral inducer under non-inductive long-day (LD) conditions.
These findings imply that Hd1, an evolutionally conserved transcriptional activator, can function as a strong transcriptional repressor within a monocot-specific flowering-time pathway through with Ghd7.
These findings suggest that Hd1 alone essentially acts as a promoter of heading date, and the protein interaction between Ghd7 and Hd1 determines photoperiod sensitivity and integrated Hd1-mediated and Ehd1-mediated flowering pathways in rice.
Importance of the Interaction between Heading Date Genes Hd1 and Ghd7 for Controlling Yield Traits in Rice.
In this study, influences of interaction between Hd1 and Ghd7 on flowering time and yield traits were analyzed using near isogenic lines derived from a cross between indica rice cultivars ZS97 and MY46.
Ghd7 is a major regulator of flowering time in rice, which strongly delays flowering under LD.
We also found that co-expressing OsGI with Ghd7 causes reduced accumulation of Ghd7 protein and partially suppresses the delayed flowering phenotype in the wild type background, suggesting that phytochromes and OsGI play antagonist roles in regulating Ghd7 protein stability and flowering time.
This study was carried out to explore the transcription factor binding site (TFBS) architecture of the Ghd7 promoter to identify the regulatory dynamics of Ghd7 transcription.
In addition to the previously identified 8 cis-elements, 448 novel cis-elements were identified in the Ghd7 promoter that provide binding sites for 25 transcription factor families.
The identified transcription factor families include key transcription factors involved in both development and abiotic stress responses, revealing the regulatory dynamics of Ghd7.
The architecture of the Ghd7 promoter reveals the roles of Ghd7 in growth, development and the abiotic stress response in rice.
Ghd7 delays the plant’s flowering under long-day conditions, which ultimately results in increased yield.
Recent findings indicate that Ghd7 also plays a major role in the abiotic stress response; however, the fine regulatory mechanisms controlling Ghd7 expression have yet to be uncovered.
This study supports the model that Ghd7 acts as a central regulator of rice growth, development, and the abiotic stress response.
OsGhd7 is a functional allele of the Ghd7 gene family; knockouts of OsGhd7 generated by CRISPR-Cas9 significantly accelerated flowering time and the earliness of the flowering time depended on field location.
Genetic effect of a new allele for the flowering time locus Ghd7 in rice.
Segregation analysis using an F2 population derived from the cross between Hoshinoyume and Sorachi demonstrated that the Ghd7 locus contributed to extremely early flowering time in Sorachi.
This Ghd7 allele in Sorachi showed a weak function in terms of delay of flowering time, compared with loss-of-function allele, and a distinct distribution in northern Japan.
We also revealed that PhyB can control Ghd7 repressor activity as a temperature sensor to inhibit Ehd1, Hd3a, and RFT1 at lower temperatures, likely through a post-transcriptional regulation, despite inductive photoperiod conditions.
In addition to delayed flowering because of low growth rates, we found that photoperiodic flowering is clearly enhanced by both Hd1 and Ghd7 genes under low-temperature conditions in rice.
The rising of ambient temperatures in early summer would contribute to inhibition of Ghd7 repressor activity, resulting in the appropriate floral induction of rice in temperate climates.
A Ghd7 involved transcriptional regulatory network has been established, but its translational regulatory pathway is poorly understood.
Ghd7 is an important gene involving in photoperiod flowering pathway in rice.
These findings are helpful to deeply understand the Ghd7 involved photoperiod flowering pathway and promote the elucidation of rice heading.

Functional Keywords

Literature and News

Gene Resources

Sequences

cDNA Sequence

>LOC_Os07g15770.1
ATGGGGATGGCCAATGAGGAGTCGCCAAATTATCAGGTGAAAAAAGGCGGCCGGATTCCTCCACCTCGATCGAGTTTGATTTATCCGTTCATGTCGATGGGACCAGCAGCCGGAGAAGGATGTGGCCTGTGCGGCGCCGACGGTGGCGGCTGTTGCTCCCGCCATCGCCACGATGATGATGGATTCCCCTTCGTCTTCCCGCCGAGTGCGTGCCAGGGGATCGGCGCCCCGGCGCCACCGGTGCACGAGTTCCAGTTCTTCGGCAACGACGGCGGCGGCGACGACGGCGAGAGCGTGGCCTGGCTGTTCGATGACTACCCGCCGCCGTCGCCCGTTGCTGCCGCCGCCGGGATGCATCATCGGCAGCCGCCGTACGACGGCGTCGTGGCGCCGCCGTCGCTGTTCAGGAGGAACACCGGCGCCGGCGGGCTCACGTTCGACGTCTCCCTCGGCGAACGGCCCGACCTGGACGCCGGGCTCGGCCTCGGCGGCGGCGGCGGCCGGCACGCCGAGGCCGCGGCCAGCGCCACCATCATGTCATATTGTGGGAGCACGTTCACTGACGCAGCGAGCTCGATGCCCAAGGAGATGGTGGCCGCCATGGCCGATGATGGGGAGAGCTTGAACCCAAACACGGTGGTTGGCGCAATGGTGGAGAGGGAGGCCAAGCTGATGAGGTACAAGGAGAAGAGGAAGAAGAGGTGCTACGAGAAGCAAATCCGGTACGCGTCCAGAAAAGCCTATGCCGAGATGAGGCCCCGAGTGAGAGGTCGCTTCGCCAAAGAACCTGATCAGGAAGCTGTCGCACCGCCATCCACCTATGTCGATCCTAGTAGGCTTGAGCTTGGACAATGGTTCAGATAG

CDS Sequence

>LOC_Os07g15770.1
ATGGGGATGGCCAATGAGGAGTCGCCAAATTATCAGGTGAAAAAAGGCGGCCGGATTCCTCCACCTCGATCGAGTTTGATTTATCCGTTCATGTCGATGGGACCAGCAGCCGGAGAAGGATGTGGCCTGTGCGGCGCCGACGGTGGCGGCTGTTGCTCCCGCCATCGCCACGATGATGATGGATTCCCCTTCGTCTTCCCGCCGAGTGCGTGCCAGGGGATCGGCGCCCCGGCGCCACCGGTGCACGAGTTCCAGTTCTTCGGCAACGACGGCGGCGGCGACGACGGCGAGAGCGTGGCCTGGCTGTTCGATGACTACCCGCCGCCGTCGCCCGTTGCTGCCGCCGCCGGGATGCATCATCGGCAGCCGCCGTACGACGGCGTCGTGGCGCCGCCGTCGCTGTTCAGGAGGAACACCGGCGCCGGCGGGCTCACGTTCGACGTCTCCCTCGGCGAACGGCCCGACCTGGACGCCGGGCTCGGCCTCGGCGGCGGCGGCGGCCGGCACGCCGAGGCCGCGGCCAGCGCCACCATCATGTCATATTGTGGGAGCACGTTCACTGACGCAGCGAGCTCGATGCCCAAGGAGATGGTGGCCGCCATGGCCGATGATGGGGAGAGCTTGAACCCAAACACGGTGGTTGGCGCAATGGTGGAGAGGGAGGCCAAGCTGATGAGGTACAAGGAGAAGAGGAAGAAGAGGTGCTACGAGAAGCAAATCCGGTACGCGTCCAGAAAAGCCTATGCCGAGATGAGGCCCCGAGTGAGAGGTCGCTTCGCCAAAGAACCTGATCAGGAAGCTGTCGCACCGCCATCCACCTATGTCGATCCTAGTAGGCTTGAGCTTGGACAATGGTTCAGATAG

Protein Sequence

>LOC_Os07g15770.1
MGMANEESPNYQVKKGGRIPPPRSSLIYPFMSMGPAAGEGCGLCGADGGGCCSRHRHDDDGFPFVFPPSACQGIGAPAPPVHEFQFFGNDGGGDDGESVAWLFDDYPPPSPVAAAAGMHHRQPPYDGVVAPPSLFRRNTGAGGLTFDVSLGERPDLDAGLGLGGGGGRHAEAAASATIMSYCGSTFTDAASSMPKEMVAAMADDGESLNPNTVVGAMVEREAKLMRYKEKRKKRCYEKQIRYASRKAYAEMRPRVRGRFAKEPDQEAVAPPSTYVDPSRLELGQWFR*