Rc;qSD7-1

Gene Details

MSU gene ID: LOC_Os07g11020
RAPdb gene ID: Os07g0211500
Gene Symbol: Rc qSD7-1 qPC7
Genome: MSU7 , IRGSP-1.0
Species: Oryza sativa

Functional Descriptions

The locus sh-h for shattering was tightly linked to the Rc locus conferring red pericarp, as well as a QTL qSD(s)-7-1 for seed dormancy, implying that this region might represent a domestication block in the evolutionary pathway of rice.
This research delimited qSD7-1/qPC7 to the Os07g11020 or Rc locus encoding a basic helix-loop-helix family transcription factor by intragenic recombinants and provided unambiguous evidence that the association arises from pleiotropy.
The breaking tensile strength (BTS) of the grain pedicel was measured using a digital foRce gauge to evaluate the degree of shattering of rice varieties at 5, 10, 15, 20, 25, 30, 35, and 40 days after heading (DAH).
Rc is a domestication-related gene required for red pericarp in rice (Oryza sativa).
The association was linked to qSD7-1/qPC7, a cluster of quantitative trait loci for seed dormancy/pericarp color in weedy red rice.
Here, we examined three more FNPs in two domestication-related genes involved in pigment synthesis during the development of seed pericarp color (Rc and Rd) in 91 landraces (and some modern cultivars) of japonica rice collected from throughout the area of distribution of rice.
The Rc locus regulates pigmentation of the rice bran layer, and selection for the Rc allele (white pericarp) occurred during domestication of the crop.
A natural mutation in Rc reverts white-rice-pericarp to red and results in a new, dominant, wild-type allele: Rc-g.
Brown-colored seeds were obtained from transgenic plants by the introduction of a gene containing the basic helix-loop-helix (bHLH) motif, demonstrating that the Rc gene encodes a bHLH protein.
In some cases, white pericarps in African rice are apparently caused by unique mutations at the Rc gene, which also controls pericarp colour variation in Asian rice.
The molecular basis of white pericarps in African domesticated rice: novel mutations at the Rc gene.
The dormancy effect could be eliminated by a heat treatment, but could not be completely oveRcome by gibberellic acid or physical removal of the seed maternal tissues.
A little less than one Mb of japonica DNA hitchhiked with the Rc allele into most indica varieties, suggesting that other linked domestication alleles may have been transferred from japonica to indica along with white pericarp color.
By sequencing the Rc locus in plants derived from red seeds, and linkage analysis in a segregating population, we were able to demonstrate that mutation within Rc resulted in the new, dominant, wild-type allele Rc-g.
RT-PCR experiments confirmed that the Rc gene was expressed in both red- and white-grained rice but that a shortened transcript was present in white varieties.
The Rc and Rd genes are involved in proanthocyanidin synthesis in rice pericarp.
In this model, the critical role of the Rc FNP at an early step of the domestication process was highlighted.
Here we report that the change from the red seeds of wild rice to the white seeds of cultivated rice (Oryza sativa) resulted from the strong selective sweep of a single mutation, a frame-shift deletion within the Rc gene that is found in 97.
Caught red-handed: Rc encodes a basic helix-loop-helix protein conditioning red pericarp in rice.
The RcRd genotype produces red pericarp in wild species Oryza rufipogon, whereas most cultivated rice varieties produce white grains resulted from a 14-bp frame-shift deletion in the seventh exon of the Rc gene.
In the present study, we developed a CRISPR/Cas9-mediated method to functionally restore the recessive Rc allele through reverting the 14-bp frame-shift deletion to in-frame mutations in which the deletions were in multiples of three bases, and successfully converted three elite white pericarp rice varieties into red ones.
Transcription Factors Rc and OsVP 1 Coordinately Regulate Preharvest Sprouting Tolerance in Red Pericarp Rice.
To identify this association’s molecular mechanism, a PHS mutant Osviviparous1 (Osvp1) was characterized in rice and crossed with Kasalath, a red pericarp cultivar with Rc (red coleoptiles) genotype.
Moreover, OsVP1 can directly bind Rc (bHLH) promoter by yeast one-hybrid, which activates Rc and OsLAR expression in red pericarp rice.
SNPs located in or close to Rc were particularly predictive of the occurrence of seed coat color and our results showed that different sub-populations required different SNPs for a better seed coat color prediction.
The significant single nucleotide polymorphism in the most prominent region was located within the Rc gene, encoding a basic helix-loop-helix transcription factor.
Identification of the rice Rc gene as a main regulator of seed survival under dry storage conditions.
In the seed pericarp, a functional Rc gene results in accumulation of proanthocyanidins, an important sub-class of flavonoids having strong antioxidant activity, which may explain the variation in tolerance to dry EPPO aging.
Storage experiments using near-isogenic rice lines (SD7-1D (Rc) and SD7-1d (Rc) with the same allelic variation confirmed the role of the wildtype Rc gene, providing stronger tolerance to dry EPPO aging.

Functional Keywords

Literature and News

Gene Resources

Sequences

cDNA Sequence

>LOC_Os07g11020.1
ATGGCCGGCGGCGAGGCGCATGCGGCGCTGCAGGCGGTGGCGCAGAGCCTCCGGTGGACCTACAGCCTCCTCTGGCAGCTCTGCCCCCACCAAGGGAGCTCGCTGGTGTGGGGGGAGGGGCACTACAACGGCGCCGTCAAGACGCGGAAGTCGACGGTGATGCAGCCGCCGCCGGCGGAGGAGGAGGACGACGCCGACCACGCGGCGCGCCACCGGAGCCGGCAGCTGAGGGAGCTCTACGACTGGCTGCAGCAGGCCGGGGAGAACTCCAGCGGCGGCGTGCAGACGTCGTCGACGACGGCGAGCCGGCGGCCGGGGGCGGCTCTGTCGCCGGAGGACCTGACGGAGACGGAGTGGTTCTTCCTCATGTCGGCATCCTACTCCTTCCCTCCCGGCATCGGGTTACCTGGAAGGGCATTTGCAAGGAGAGGCCATGTATGGCTCACTGGAGCAAATGAAGTTGACAGCAAAGTATTCCTAAGAGCAATTCTTGCCAAGACAGTTGTGTGCATTCCTGTTGTCGATGGCGTCCTGGAAATTGGAACTACGGAAAAGGTGGAGGAAGATATGGGCCTGATTCAGTATGCAAGGGGCATCTTCATGGATCAACATGGCATCCACATGAAGCCTACCCTCTCACAGCACTCAACATCCAACCCAGTCACCCACTGTACTCATCAGCATCCAATCCAGGTTCAGATGCAACTAGGTATCACCAGCCAAACAAAGTTTGATTATTCAGATGAGCTCAATGCAGATGAGGAGAATGATGACACAGAAGAAGAGGGCATGTCAGGTTCAGACACTAACAACACTGACACTGAAAGGAATTCAGGCCAGCTGCAACTTCAAATGCAAGACCAACTGAACATGGTGAGCAATGACCACCAGACAATACCAAATAATGCAGTTTCCAGTGAGCTAATGCAGTGTGAGATGTCAGAAGTGGTAAGAGATGGCTGCTCAAATAATATTTTAGAGGATGAAATCCAAATGCTGATGGATTGCCAAAACAGTAATTGTCAGTTAAATTTGCAAGGGCCAGATGAGCCTTGTCACTCTTGGCATTTTCTCTGCGAGGAGTTACAAAATGATTACCAGCCAGCTACTGAAGATCAAGTGGCATCACCTGAAAATACCCATTACCCAAAAACACTCATGACAATCCTACATTACAACACGCTGCGACAGCAAGAGATGAACATCAAGAACTACTTGCCAGTTTCAGAGAAATCATCATTCTCCAGATGGACTACTCCTGAAGGAAGTGATGACAACAAGACCATGATCAGTCCAGGCACCACACAGAGAATGCTCAAGAGCATCCTGATGATTGTTCCCAGTAGTCACTGCAGTTACAGGGGAGCAGAAACACCTGAATCAAGGGGCGGGAAAGGCGCAAGTGGATGCCATCCAAGGTGATTTCAGTGCCAACCATGTGCTGAAAGAGAGGAGAAGAAGAGAGAAGCTCAATGAGAAGTTCATAATTCTGCGATCTTTGGTACCTTTCATGACAAAGATGGACAAGGCGTCGATACTAGGCGACACGATCGAGTACGTGAAGCAGCTAAGGAACCGCATACAAGAGCTCGAGTCGTCGTCGTCGTCGTCACGAGCAGCCGCCCGGGCGCCATCGGCGGCGGCCGCCGGGAGGCGGAGGAAGAGATCCGCCGCCGCCGCCACTGCCACGGCGGCGGAAGGGATGAGCAGCAGCAATGGCCGCAATGGCGGCGAGGCGGCGGAGGTGGTGCAGGTGTCCATCATCGAGAGCGACGCGCTGCTGGAGCTCCGGTGCGGTTGCGGCGGCGGCGGCGGCGGTGTGGTGCTGCTCCGGGTGATGCAGGCGATGCAGGAGCTCCAGCTGGAGGTCACCGCCGTCCAGGCCTCGTGCGCCGGTGGCGAGCTGCTCGCCGAGCTGCGCGCCAAGGTCGTCGTTATGATCCTGATCTGCATGAAAATGCAAATGCAAATGCAAATGCAGAATTAA

CDS Sequence

>LOC_Os07g11020.1
ATGGCCGGCGGCGAGGCGCATGCGGCGCTGCAGGCGGTGGCGCAGAGCCTCCGGTGGACCTACAGCCTCCTCTGGCAGCTCTGCCCCCACCAAGGGAGCTCGCTGGTGTGGGGGGAGGGGCACTACAACGGCGCCGTCAAGACGCGGAAGTCGACGGTGATGCAGCCGCCGCCGGCGGAGGAGGAGGACGACGCCGACCACGCGGCGCGCCACCGGAGCCGGCAGCTGAGGGAGCTCTACGACTGGCTGCAGCAGGCCGGGGAGAACTCCAGCGGCGGCGTGCAGACGTCGTCGACGACGGCGAGCCGGCGGCCGGGGGCGGCTCTGTCGCCGGAGGACCTGACGGAGACGGAGTGGTTCTTCCTCATGTCGGCATCCTACTCCTTCCCTCCCGGCATCGGGTTACCTGGAAGGGCATTTGCAAGGAGAGGCCATGTATGGCTCACTGGAGCAAATGAAGTTGACAGCAAAGTATTCCTAAGAGCAATTCTTGCCAAGACAGTTGTGTGCATTCCTGTTGTCGATGGCGTCCTGGAAATTGGAACTACGGAAAAGGTGGAGGAAGATATGGGCCTGATTCAGTATGCAAGGGGCATCTTCATGGATCAACATGGCATCCACATGAAGCCTACCCTCTCACAGCACTCAACATCCAACCCAGTCACCCACTGTACTCATCAGCATCCAATCCAGGTTCAGATGCAACTAGGTATCACCAGCCAAACAAAGTTTGATTATTCAGATGAGCTCAATGCAGATGAGGAGAATGATGACACAGAAGAAGAGGGCATGTCAGGTTCAGACACTAACAACACTGACACTGAAAGGAATTCAGGCCAGCTGCAACTTCAAATGCAAGACCAACTGAACATGGTGAGCAATGACCACCAGACAATACCAAATAATGCAGTTTCCAGTGAGCTAATGCAGTGTGAGATGTCAGAAGTGGTAAGAGATGGCTGCTCAAATAATATTTTAGAGGATGAAATCCAAATGCTGATGGATTGCCAAAACAGTAATTGTCAGTTAAATTTGCAAGGGCCAGATGAGCCTTGTCACTCTTGGCATTTTCTCTGCGAGGAGTTACAAAATGATTACCAGCCAGCTACTGAAGATCAAGTGGCATCACCTGAAAATACCCATTACCCAAAAACACTCATGACAATCCTACATTACAACACGCTGCGACAGCAAGAGATGAACATCAAGAACTACTTGCCAGTTTCAGAGAAATCATCATTCTCCAGATGGACTACTCCTGAAGGAAGTGATGACAACAAGACCATGATCAGTCCAGGCACCACACAGAGAATGCTCAAGAGCATCCTGATGATTGTTCCCAGTAGTCACTGCAGTTACAGGGGAGCAGAAACACCTGAATCAAGGGGCGGGAAAGGCGCAAGTGGATGCCATCCAAGGTGA

Protein Sequence

>LOC_Os07g11020.1
MAGGEAHAALQAVAQSLRWTYSLLWQLCPHQGSSLVWGEGHYNGAVKTRKSTVMQPPPAEEEDDADHAARHRSRQLRELYDWLQQAGENSSGGVQTSSTTASRRPGAALSPEDLTETEWFFLMSASYSFPPGIGLPGRAFARRGHVWLTGANEVDSKVFLRAILAKTVVCIPVVDGVLEIGTTEKVEEDMGLIQYARGIFMDQHGIHMKPTLSQHSTSNPVTHCTHQHPIQVQMQLGITSQTKFDYSDELNADEENDDTEEEGMSGSDTNNTDTERNSGQLQLQMQDQLNMVSNDHQTIPNNAVSSELMQCEMSEVVRDGCSNNILEDEIQMLMDCQNSNCQLNLQGPDEPCHSWHFLCEELQNDYQPATEDQVASPENTHYPKTLMTILHYNTLRQQEMNIKNYLPVSEKSSFSRWTTPEGSDDNKTMISPGTTQRMLKSILMIVPSSHCSYRGAETPESRGGKGASGCHPR*