Information report for RNRS1;St1
Gene Details
|
|
Functional Descriptions
- RNRL1 and RNRS1 are highly expressed in the shoot base and in young leaves, and the expression of the genes that function in plastid transcription/translation and in photosynthesis is altered in v3 and st1 mutants, indicating that a threshold activity of RNR is required for chloroplast biogenesis in developing leaves.
- The virescent3 (v3) and stripe1 (St1) mutants in rice (Oryza sativa) produce chlorotic leaves in a growth stage-dependent manner under field conditions.
- Moreover, wild-type plants exposed to a low concentration of an RNR inhibitor, hydroxyurea, produce chlorotic leaves without growth retardation, reminiscent of v3 and St1 mutants.
- There were fewer chloroplasts and grana lamellas in SDL leaf compared with those of wild-type.
- Additionally, the stripe leaf of SDL seedlings was highly sensitive to temperature, since the chlorophyll content was increased with the temperature rising.
- The drooping leaf of SDL might be resulted from the disappearance of vascular bundles and mesophyll cells in both leaf midrib and lateral veins.
- The mutant SDL exhibited development defects including stripe and drooping leaf, dwarfism and deformed floral organs.
- The gene SDL was found allelic to RNRS1 by map-based cloning, which was homologous to Arabidopsis TSO2 encoding the small subunit of ribonucleotide reductase.
- Fittingly to the phenotypes of mutant SDL, the expression levels of genes associated with photosynthesis and chlorophyll synthesis were found to be down- or up-regulated at different temperatures in mutant SDL.
- Also, the transcriptional levels of genes related to plant height and floral organ formation showed obvious differences between wild-type and SDL.
- The redundant sequence was conserved in SDL homologous proteins, which contained the active site (tyrosine), as well as two amino acids glutamate and histidine involved in the binding of iron.
- CONCLUSIONS: Our findings here suggest that NSL2 function in the synthesis of dNTP, the deficient of which leads to DNA synthesis block and in turn affects cell cycle progression, and ultimately decreased cell number and narrow leaf in the NSL2 plant.
- The NSL2 was expressed in variety of tissues, with the highest levels detected in leaves, and its protein was localized in the nucleus and cytoplasm.
- In addition, flow cytometric analysis and the altered transcript level of genes related to cell cycle indicated that NSL2 affects cell cycle progression.
Functional Keywords
- shoot , chloroplast , growth , photosynthesis , leaf , seedlings , vascular-bundle , temperature , development , map-based-cloning , floral , floral-organ , height , plant-height , iron , nucleus , cytoplasm , cell-cycle
Literature and News
- Rice virescent3 and stripe1 encoding the large and small subunits of ribonucleotide reductase are required for chloroplast biogenesis during early leaf development . DOI: 10.1104/pp.109.136648 ; PMID: 19297585
- Rice gene SDL/RNRS1, encoding the small subunit of ribonucleotide reductase, is required for chlorophyll synthesis and plant growth development . DOI: 10.1016/j.gene.2017.05.059 ; PMID: 28578018
- Narrow and Stripe Leaf 2 Regulates Leaf Width by Modulating Cell Cycle Progression in Rice . DOI: 10.1186/s12284-023-00634-3 ; PMID: 37071312
Gene Resources
- UniProt: Q652T5
- EMBL: AP005527, AP005619
- AlphaFoldDB: Q652T5
- EnsemblPlants: Os06t0257450-01
- Gramene: Os06t0257450-01
- KEGG: osa:9266846
- Orthologous matrix: LGYEAMF
- InterPro: IPR000358, IPR009078, IPR012348
- PANTHER: PTHR23409, PTHR23409:SF18
- SUPFAM: SSF47240
- PROSITE: PS00368
- Gene3D: 1.10.620.20
- SWISS-MODEL: Q652T5
- Conserved Domain Database: cd01049
Sequences
cDNA Sequence
- >LOC_Os06g14620.1
ACGCCGCCGCCGCCGAATCCCCACAACCCCAAATCCCCATCCAGAAACCACCCCGATCCGCGACGAAGATGCCGGCCGCGCCGACGCTGGTGCCCGCCTGCGACCTGGAGGAGCCGCTGCTGGCGGAGTCGTCCGAGCGATTCTCGATGTTCCCGATCAGGTACCCGCAGATCTGGGAGTTCTACAAGAAGGCGGTGGCGTCGTTCTGGACGGCGGAGGAGGTGGACCTCTCCGCCGACGCGCGCCACTGGGACGCCGCGCTGTCCCCCGACGAGCGCCACTTCATCTCCCACGTGCTCGCCTTCTTCGCCGCCTCCGACGGCATCGTGCTCGAGAACCTCGCCTCCAGGTTCATGTCCGACGTGCAGGTCGCCGAGGCGCGCGCCTTCTACGGATTCCAGATCGCCATCGAGAACATCCACTCTGAGATGTACTCGCTGCTGCTCGAGACCTACATCCGCGACGGCGCCGAGAAGGACCGGCTGTTCCGCGCCATCGACACCGTCCCGGCCGTGCGCCGCAAGGCCGACTGGGCCATGCGCTGGATCGACGGCGGCGAGCGCTTCGCCGAGCGCCTCGTCGCCTTCGCCTGCGTCGAGGGGATCTTCTTCTCGGGCTCCTTCTGCGCCATCTTCTGGCTCAAGAAGCGGGGGCTCATGCCGGGCCTCACCTTCTCCAACGAGCTCATCTCCCGCGACGAGGGCCTGCACTGCGACTTCGCCTGCCTCCTCTACGACCTCCTCCGCGGCAAGCTCGACGAGGCGCGCGTCCGCGAGATCGTCGCCGACGCCGTCGACATCGAGAGGGAGTTCGTCTGCGACGCGCTCCCCGTCGCGCTCGTCGGCATGAACGGCGACCTCATGAGCCAGTACATCGAGTTCGTCGCCGACCGCCTCCTCATGGCGCTCGGCTGCAAGAAGATGTACAACGTCGCTAACCCCTTCGACTGGATGGAGCTCATATCCCTGCAGGGCAAGACCAACTTCTTCGAGAAGCGCGTCGGCGACTACCAGAAGGCGTCCGTCATGTCGAGCCTCAACGGCGGCGCCTCCGCCAACCACGTCTTCAGCATCGACGAAGACTTCTGATTTGCCAATCTCCTCGTGTACATCTCCAACCCTCGCAGTCACTTGCTCTCTGCCCCCCCTTACTAGTAGTAGTAGTAATACATGCGCGTGGTGCTCCCTAATGTTATAGTTGGTGTGTTGCTGGTTCTTGTTGGTGATGTATCCTAATGAATTATGAATCCAGTTGTTTAGTATCAGCTGCCCGTGTCCTGCACGCAGGGTGTTCGACGAAATGGCTGAGGCCTAAGCTAATGTGTGCGCGCAGCCAGGGCGTTCGACCAAATGCCTACACGACGCCGTGCCAGTCTGGGAGTGCAGGCAAGGCGTTCGGTGAAATGCCTGGGAGGATAAGGGGTTGGGGACGGATTAGGGTTTTAGGAGAGCGCGGGACCATCTCCTGGCGGCTGGTTGCGGCGCGCCAGATTTGCCGGCCTTGGCGCCTGGCCCAGTAGTACACAGAATCTACATGTGAATCGCAGCTGTAACTTTCAGTTGGATAATATTGTAACGGTGAGATTTCAGTTTTTGTACCTATCTGTCAATCTTTTGTTAATCTGTAGTACTAATATCAATCTACCTTTGGT
CDS Sequence
- >LOC_Os06g14620.1
ATGCCGGCCGCGCCGACGCTGGTGCCCGCCTGCGACCTGGAGGAGCCGCTGCTGGCGGAGTCGTCCGAGCGATTCTCGATGTTCCCGATCAGGTACCCGCAGATCTGGGAGTTCTACAAGAAGGCGGTGGCGTCGTTCTGGACGGCGGAGGAGGTGGACCTCTCCGCCGACGCGCGCCACTGGGACGCCGCGCTGTCCCCCGACGAGCGCCACTTCATCTCCCACGTGCTCGCCTTCTTCGCCGCCTCCGACGGCATCGTGCTCGAGAACCTCGCCTCCAGGTTCATGTCCGACGTGCAGGTCGCCGAGGCGCGCGCCTTCTACGGATTCCAGATCGCCATCGAGAACATCCACTCTGAGATGTACTCGCTGCTGCTCGAGACCTACATCCGCGACGGCGCCGAGAAGGACCGGCTGTTCCGCGCCATCGACACCGTCCCGGCCGTGCGCCGCAAGGCCGACTGGGCCATGCGCTGGATCGACGGCGGCGAGCGCTTCGCCGAGCGCCTCGTCGCCTTCGCCTGCGTCGAGGGGATCTTCTTCTCGGGCTCCTTCTGCGCCATCTTCTGGCTCAAGAAGCGGGGGCTCATGCCGGGCCTCACCTTCTCCAACGAGCTCATCTCCCGCGACGAGGGCCTGCACTGCGACTTCGCCTGCCTCCTCTACGACCTCCTCCGCGGCAAGCTCGACGAGGCGCGCGTCCGCGAGATCGTCGCCGACGCCGTCGACATCGAGAGGGAGTTCGTCTGCGACGCGCTCCCCGTCGCGCTCGTCGGCATGAACGGCGACCTCATGAGCCAGTACATCGAGTTCGTCGCCGACCGCCTCCTCATGGCGCTCGGCTGCAAGAAGATGTACAACGTCGCTAACCCCTTCGACTGGATGGAGCTCATATCCCTGCAGGGCAAGACCAACTTCTTCGAGAAGCGCGTCGGCGACTACCAGAAGGCGTCCGTCATGTCGAGCCTCAACGGCGGCGCCTCCGCCAACCACGTCTTCAGCATCGACGAAGACTTCTGA
Protein Sequence
- >LOC_Os06g14620.1
MPAAPTLVPACDLEEPLLAESSERFSMFPIRYPQIWEFYKKAVASFWTAEEVDLSADARHWDAALSPDERHFISHVLAFFAASDGIVLENLASRFMSDVQVAEARAFYGFQIAIENIHSEMYSLLLETYIRDGAEKDRLFRAIDTVPAVRRKADWAMRWIDGGERFAERLVAFACVEGIFFSGSFCAIFWLKKRGLMPGLTFSNELISRDEGLHCDFACLLYDLLRGKLDEARVREIVADAVDIEREFVCDALPVALVGMNGDLMSQYIEFVADRLLMALGCKKMYNVANPFDWMELISLQGKTNFFEKRVGDYQKASVMSSLNGGASANHVFSIDEDF*