Information report for OsWRKY53
Gene Details
|
|
Functional Descriptions
- OsWRKY53, a chitin oligosaccharide elicitor-responsive rice WRKY gene, has been found to be involved in defense responses in rice.
- Promoter Analysis of the Elicitor-Induced WRKY GeneOsWRKY53, Which Is Involved in Defense Responses in Rice.
- We identified three tandem W-box elements, putative recognition sites for WRKY transcription factors, as cis elements that are essential to the elicitor-responsiveness of OsWRKY53 by deletion and mutation analysis of the promoter by dual luciferase assay.
- OsWRKY53 was also induced in suspension-cultured rice cells by a fungal cerebroside elicitor and in rice plants by infection with the blast fungus Magnaporthe grisea.
- A microarray analysis revealed that several defense-related genes, including pathogenesis-related protein genes such as PBZ1, were upregulated in rice cells overexpressing OsWRKY53.
- These results strongly suggest that OsWRKY53 is a transcription factor that plays important roles in elicitor-induced defense signaling pathways in rice.
- Involvement of the elicitor-induced gene OsWRKY53 in the expression of defense-related genes in rice.
- Involvement of the OsMKK4-OsMPK1 Cascade and its Downstream Transcription Factor OsWRKY53 in the Wounding Response in Rice.
- Taken together, components involving in the wounding signaling pathway, OsMKK4-OsMPK1-OsWRKY53, can be important players in regulating crosstalk between abiotic stress and biotic stress.
- OsWRKY53 is also shown to be a negative regulator of plant growth.
- The transcript levels of OsWRKY53 are independent of endogenous jasmonic acid (JA), but positively regulated by the mitogen-activated protein kinases (MPKs), OsMPK3/OsMPK6.
- Recently, a rice WRKY transcription factor OsWRKY53 has been reported to function as a negative feedback modulator of OsMPK3/OsMPK6 and thereby to control the size of the investment a rice plant makes to defend against a chewing herbivore, the striped stem borer Chilo suppressalis.
- We investigated the performance of a piecing-sucking herbivore, the brown planthopper (BPH) Nilaparvata lugens, on transgenic plants that silence or overexpress OsWRKY53, and found that OsWRKY53 activates rice defenses against BPH by activating an H2O2 burst and suppressing ethylene biosynthesis.
- Phenotypic analyses showed that OsWRKY53 overexpression led to enlarged leaf angles and increased grain size, in contrast to the erect leaves and smaller seeds in OsWRKY53 mutant.
- Transcription factor OsWRKY53 positively regulates brassinosteroid signaling and plant architecture.
- In addition, the OsWRKY53 exhibited decreased BR sensitivity, whereas OsWRKY53 overexpression plants were hypersensitive to BR, suggesting that OsWRKY53 positively regulates rice BR signaling.
- Moreover, we show that OsWRKY53 can interact with and be phosphorylated by OsMAPKK4-OsMAPK6 cascade, and the phosphorylation is required for the biological function of OsWRKY53 in regulating BR responses.
- Furthermore, we found that BR promotes OsWRKY53 protein accumulation but represses OsWRKY53 transcript level.
- Taken together, this study revealed the novel role of OsWRKY53 as a regulator of rice BR signaling, and also suggested a potential role of OsWRKY53 in mediating the crosstalk between the hormone and other signaling pathways.
- Both OsWRKY53 and OsMYB63 are abundantly expressed in sclerenchyma cells of leaf vascular bundles.
- The OsWRKY53-overexpressing and OsMYB63 knockout plants had thinner sclerenchyma cell walls, showing susceptibility to Xoo, while the OsWRKY53 knockout and OsMYB63-overexpressing plants had thicker sclerenchyma cell walls, exhibiting resistance to Xoo.
- Silencing OsI-BAK1 (ir-ibak1) in rice enhanced the BPH-induced transcript levels of three defense-related WRKY genes (OsWRKY24, OsWRKY53 and OsWRKY70) but decreased the induced levels of ethylene.
- OsWRKY53 Promotes Abscisic Acid Accumulation to Accelerate Leaf Senescence and Inhibit Seed Germination by Downregulating Abscisic Acid Catabolic Genes in Rice.
- In this study, we showed that OsWRKY53 is a positive regulator of leaf senescence and a negative regulator of seed germination in rice.
- Chromatin immunoprecipitation and protoplast transient assays revealed that OsWRKY53 directly bound to the promoters of OsABA8ox1 and OsABA8ox2 to repress their transcription, resulting in elevated endogenous ABA contents that promoted premature leaf senescence in the OsWRKY53-oe plants.
- It indicates that OsWRKY53 is a positive regulator through regulating ABA accumulation to promote leaf senescence.
- Taken together, OsWRKY53 suppresses the transcript of ABA catabolic genes to promote ABA accumulation to modulate ABA-induced leaf senescence and ABA-mediated inhibition of seed germination.
- The OsWRKY53-overexpressing (OsWRKY53-oe) plants showed early yellowing leaves, while the OsWRKY53 (OsWRKY53) knockout mutants maintained green leaves than the wild type under natural, dark-induced, and ABA-induced senescence conditions.
- OsWRKY53 expression was induced in leaves under aging, dark, and ABA treatment.
- In addition, OsWRKY70 overexpression lines displayed an enlarged leaf angle, reduced plant height, longer grains, and higher BR sensitivity, phenotypes similar to those of OsWRKY53 overexpression lines.
- The transcription factor OsWRKY53 positively regulates grain size through brassinosteroid (BR) signaling and Mitogen-Activated Protein Kinase (MAPK) cascades.
- Functions of OsWRKY24, OsWRKY70 and OsWRKY53 in regulating grain size in rice.
- OsWRKY24 functions redundantly with OsWRKY53, while OsWRKY70 functions differently from OsWRKY53 in regulating grain size.
- However, whether the OsWRKY53 homologs OsWRKY24 and OsWRKY70 also contribute to grain size which remains unknown.
- Importantly, a systematic characterization of seed length in the oswrky70 single, the OsWRKY53 oswrky70 double and the oswrky24 OsWRKY53 oswrky70 triple mutant indicated that loss of OsWRKY70 also leads to increased seed length, suggesting that OsWRKY70 might play a role distinct from that of OsWRKY53 in regulating grain size.
- Taken together, these findings suggest that OsWRKY24 and OsWRKY70 regulate rice grain size redundantly and independently from OsWRKY53.
Functional Keywords
- defense , transcription-factor , defense-response , blast , wounding-response , biotic-stress , growth , jasmonic , jasmonic-acid , plant-growth , protein-kinase , stem , ethylene , brown-planthopper , leaf , grain , grain-size , brassinosteroid , BR , Brassinosteroid , BR-signaling , erect , Brassinosteroid-Signaling , plant-architecture , vascular-bundle , resistance , cell-wall , leaf-senescence , senescence , seed , seed-germination , ABA , abscisic-acid , Kinase , kinase , plant-height , leaf-angle , seed-length
Literature and News
- Involvement of the elicitor-induced gene OsWRKY53 in the expression of defense-related genes in rice . DOI: 10.1016/j.bbaexp.2007.04.006 ; PMID: 17532485
- Promoter analysis of the elicitor-induced WRKY gene OsWRKY53, which is involved in defense responses in rice . DOI: 10.1271/bbb.90262 ; PMID: 19661718
- The WRKY Gene Family in Rice (Oryza sativa) . DOI: 10.1111/j.1744-7909.2007.00504.x
- Involvement of the OsMKK4-OsMPK1 Cascade and its Downstream Transcription Factor OsWRKY53 in the Wounding Response in Rice . DOI: 10.5423/PPJ.OA.10.2013.0106 ; PMID: 25288999
- The Rice Transcription Factor WRKY53 Suppresses Herbivore-Induced Defenses by Acting as a Negative Feedback Modulator of Mitogen-Activated Protein Kinase Activity . DOI: 10.1104/pp.15.01090 ; PMID: 26453434
- OsWRKY53, a versatile switch in regulating herbivore-induced defense responses in rice . DOI: 10.1080/15592324.2016.1169357 ; PMID: 27031005
- Transcription Factor OsWRKY53 Positively Regulates Brassinosteroid Signaling and Plant Architecture . DOI: 10.1104/pp.17.00946 ; PMID: 28894020
- Knock out of transcription factor WRKY53 thickens sclerenchyma cell walls, confers bacterial blight resistance . DOI: 10.1093/plphys/kiab400 ; PMID: 34618083
- Silencing a Simple Extracellular Leucine-Rich Repeat Gene OsI-BAK1 Enhances the Resistance of Rice to Brown Planthopper Nilaparvata lugens . DOI: 10.3390/ijms222212182 ; PMID: 34830062
- OsWRKY53 Promotes Abscisic Acid Accumulation to Accelerate Leaf Senescence and Inhibit Seed Germination by Downregulating Abscisic Acid Catabolic Genes in Rice . DOI: 10.3389/fpls.2021.816156 ; PMID: 35154213
- Functions of OsWRKY24, OsWRKY70 and OsWRKY53 in regulating grain size in rice . DOI: 10.1007/s00425-022-03871-w ; PMID: 35322309
- WRKY53 negatively regulates rice cold tolerance at the booting stage by fine-tuning anther gibberellin levels . DOI: 10.1093/plcell/koac253 ; PMID: 35972376
Gene Resources
- UniProt: Q5W6M7
- EMBL: AB190436, AP014961
- AlphaFoldDB: Q5W6M7
- EnsemblPlants: Os05t0343400-01
- Gramene: Os05t0343400-01
- KEGG: osa:4338474
- Orthologous matrix: SNAMPTQ
- InterPro: IPR003657, IPR036576, IPR044810
- PANTHER: PTHR31221, PTHR31221:SF96
- SUPFAM: SSF118290
- PROSITE: PS50811
- Gene3D: 2.20.25.80
- OrthoDB: Q5W6M7
- SWISS-MODEL: Q5W6M7
- eggNOG: ENOG502QRXJ
Sequences
cDNA Sequence
- >LOC_Os05g27730.1
ACTCCCGTCTCGTCGTCTCGTTCTCGTCTCCGATCACTCTCCTCCTCATCTTCGTCACGGTCTCCTCGCTTCGCTAGCTCGCTTGCTTGCTGGCTGAGCTGTGGTACGCTCGCCATGGCGTCCTCGACGGGGGGGTTGGACCACGGGTTCACGTTCACGCCGCCGCCGTTCATCACGTCGTTCACCGAGCTGCTGTCGGGGGGCGGTGGGGACCTGCTCGGCGCCGGCGGTGAGGAGCGCTCGCCGAGGGGGTTCTCCAGAGGCGGAGCGAGGGTGGGCGGCGGGGTGCCCAAGTTCAAGTCCGCGCAGCCGCCGAGCCTGCCGCTCTCGCCGCCGCCGGTGTCGCCGTCGTCCTACTTCGCCATCCCGCCGGGGCTCAGCCCCACCGAGCTGCTCGACTCCCCCGTCCTCCTCAGCTCCTCCCATATCTTGGCGTCCCCGACCACCGGTGCAATCCCGGCTCAGAGGTACGACTGGAAGGCCAGCGCCGATCTCATCGCTTCTCAGCAAGATGACAGCCGCGGCGACTTCTCCTTCCACACCAACTCCGACGCCATGGCCGCGCAACCGGCCTCTTTCCCTTCCTTCAAGGAGCAAGAGCAGCAAGTGGTCGAGTCGAGCAAGAACGGCGCCGCCGCCGCGTCGAGCAACAAGAGCGGCGGCGGCGGGAACAACAAGCTGGAGGACGGGTACAACTGGAGGAAGTACGGGCAGAAGCAGGTGAAGGGGAGCGAGAACCCGAGGAGCTACTACAAGTGCACCTACAACGGCTGCTCCATGAAGAAGAAGGTGGAGCGCTCGCTCGCCGACGGCCGCATCACCCAGATCGTCTACAAGGGCGCACACAACCACCCCAAGCCGCTCTCCACCCGCCGCAACGCCTCCTCCTGCGCCACCGCCGCCGCCTGCGCCGACGACCTCGCGGCGCCCGGCGCGGGCGCGGACCAGTACTCCGCCGCGACGCCCGAGAACTCCTCCGTCACGTTCGGCGACGACGAGGCCGACAACGCATCGCACCGCAGCGAGGGCGACGAGCCCGAAGCCAAGCGCTGGAAGGAGGATGCTGACAACGAGGGCAGCTCCGGCGGCATGGGCGGCGGCGCCGGCGGCAAGCCGGTGCGCGAGCCGAGGCTTGTGGTGCAGACGCTGAGCGACATCGACATCCTCGACGACGGCTTCCGGTGGAGGAAGTACGGCCAGAAGGTCGTCAAGGGCAACCCCAACCCAAGGAGCTACTACAAGTGCACGACGGTGGGCTGCCCGGTGCGGAAGCACGTGGAGCGGGCGTCGCACGACACGCGCGCCGTGATCACCACCTACGAGGGCAAGCACAACCACGACGTCCCGGTCGGCCGCGGCGGCGGCGGCGGACGCGCCCCGGCGCCGGCGCCGCCGACGTCGGGGGCGATCCGGCCGTCGGCCGTCGCCGCCGCCCAGCAGGGGCCCTACACCCTCGAGATGCTCCCCAACCCCGCCGGCCTCTACGGCGGCTACGGCGCCGGCGCCGGCGGCGCCGCGTTCCCGCGCACCAAGGACGAGCGGCGGGACGACCTGTTCGTCGAGTCGCTCCTCTGCTAGTCGAGCCGAGCCGAGCCGAGCTGAGCTGGGCCCCACATCCCCCTGCTCGCCACGTGGCGTATTTTCGCCTCGCCGTATACGTACGGCCGTATAGCGTACGTATACACGCTCGCACGCCCTGCCCAACACGGCAATACACACATACATACTCTCGTACACACGTAGTAGCATACATATACAGTATAGTAGGTGGTAGTGGTAGCTAGCTAGGGAGTGAGATCCAATTTGTTGATTCGTTGCAGGCCACTGCCACGTGGGCCACACCGGAAACAGTACACGCGTATACACCACACTTGGGATACGCGTACGTACGCACATGTACACGTAGTTTTGTGCCTTTGTAACTGCTGAGAGACAGGTCAAATAAGACTGATGAATTTTTCATTTCTTAAAATTCCACTCGTGTGAATTACTAGTAGTATAAATATCTATACATGATGTTTTTACAATCTGTACCGAACTGAGAAAGAGGAAAAAAAAGAGAGAGATTTTTTTTT
CDS Sequence
- >LOC_Os05g27730.1
ATGGCGTCCTCGACGGGGGGGTTGGACCACGGGTTCACGTTCACGCCGCCGCCGTTCATCACGTCGTTCACCGAGCTGCTGTCGGGGGGCGGTGGGGACCTGCTCGGCGCCGGCGGTGAGGAGCGCTCGCCGAGGGGGTTCTCCAGAGGCGGAGCGAGGGTGGGCGGCGGGGTGCCCAAGTTCAAGTCCGCGCAGCCGCCGAGCCTGCCGCTCTCGCCGCCGCCGGTGTCGCCGTCGTCCTACTTCGCCATCCCGCCGGGGCTCAGCCCCACCGAGCTGCTCGACTCCCCCGTCCTCCTCAGCTCCTCCCATATCTTGGCGTCCCCGACCACCGGTGCAATCCCGGCTCAGAGGTACGACTGGAAGGCCAGCGCCGATCTCATCGCTTCTCAGCAAGATGACAGCCGCGGCGACTTCTCCTTCCACACCAACTCCGACGCCATGGCCGCGCAACCGGCCTCTTTCCCTTCCTTCAAGGAGCAAGAGCAGCAAGTGGTCGAGTCGAGCAAGAACGGCGCCGCCGCCGCGTCGAGCAACAAGAGCGGCGGCGGCGGGAACAACAAGCTGGAGGACGGGTACAACTGGAGGAAGTACGGGCAGAAGCAGGTGAAGGGGAGCGAGAACCCGAGGAGCTACTACAAGTGCACCTACAACGGCTGCTCCATGAAGAAGAAGGTGGAGCGCTCGCTCGCCGACGGCCGCATCACCCAGATCGTCTACAAGGGCGCACACAACCACCCCAAGCCGCTCTCCACCCGCCGCAACGCCTCCTCCTGCGCCACCGCCGCCGCCTGCGCCGACGACCTCGCGGCGCCCGGCGCGGGCGCGGACCAGTACTCCGCCGCGACGCCCGAGAACTCCTCCGTCACGTTCGGCGACGACGAGGCCGACAACGCATCGCACCGCAGCGAGGGCGACGAGCCCGAAGCCAAGCGCTGGAAGGAGGATGCTGACAACGAGGGCAGCTCCGGCGGCATGGGCGGCGGCGCCGGCGGCAAGCCGGTGCGCGAGCCGAGGCTTGTGGTGCAGACGCTGAGCGACATCGACATCCTCGACGACGGCTTCCGGTGGAGGAAGTACGGCCAGAAGGTCGTCAAGGGCAACCCCAACCCAAGGAGCTACTACAAGTGCACGACGGTGGGCTGCCCGGTGCGGAAGCACGTGGAGCGGGCGTCGCACGACACGCGCGCCGTGATCACCACCTACGAGGGCAAGCACAACCACGACGTCCCGGTCGGCCGCGGCGGCGGCGGCGGACGCGCCCCGGCGCCGGCGCCGCCGACGTCGGGGGCGATCCGGCCGTCGGCCGTCGCCGCCGCCCAGCAGGGGCCCTACACCCTCGAGATGCTCCCCAACCCCGCCGGCCTCTACGGCGGCTACGGCGCCGGCGCCGGCGGCGCCGCGTTCCCGCGCACCAAGGACGAGCGGCGGGACGACCTGTTCGTCGAGTCGCTCCTCTGCTAG
Protein Sequence
- >LOC_Os05g27730.1
MASSTGGLDHGFTFTPPPFITSFTELLSGGGGDLLGAGGEERSPRGFSRGGARVGGGVPKFKSAQPPSLPLSPPPVSPSSYFAIPPGLSPTELLDSPVLLSSSHILASPTTGAIPAQRYDWKASADLIASQQDDSRGDFSFHTNSDAMAAQPASFPSFKEQEQQVVESSKNGAAAASSNKSGGGGNNKLEDGYNWRKYGQKQVKGSENPRSYYKCTYNGCSMKKKVERSLADGRITQIVYKGAHNHPKPLSTRRNASSCATAAACADDLAAPGAGADQYSAATPENSSVTFGDDEADNASHRSEGDEPEAKRWKEDADNEGSSGGMGGGAGGKPVREPRLVVQTLSDIDILDDGFRWRKYGQKVVKGNPNPRSYYKCTTVGCPVRKHVERASHDTRAVITTYEGKHNHDVPVGRGGGGGRAPAPAPPTSGAIRPSAVAAAQQGPYTLEMLPNPAGLYGGYGAGAGGAAFPRTKDERRDDLFVESLLC*