Information report for OsWOX4
Gene Details
|
|
Functional Descriptions
- Inducible downregulation of OsWOX4 resulted in severe defects in leaf development, such as an arrest of vascular differentiation, a partial defect in the early cell proliferation required for midrib formation, and a failure to maintain cellular activity in general parenchyma cells.
- Transcriptome analysis further showed that OsWOX4 regulates multiple genes, including those responsible for cell cycle progression and hormone action, consistent with the effects of OsWOX4 downregulation on leaf phenotypes.
- Collectively, these results suggest that OsWOX4 acts as a key regulator at an early stage of leaf development.
- In situ analysis showed that knockdown of OsWOX4 reduced the expression of two LONELY GUY genes, which function in the synthesis of active cytokinin, in developing vascular bundles.
- Our previous work revealed that OsWOX4 is involved in the maintenance of shoot apical meristem in rice, whereas AtWOX4 is specifically associated with the maintenance of vascular stem cells in Arabidopsis.
- Consistent with this, cytokinin levels were downregulated by OsWOX4 knockdown.
- The WUSCHEL-related homeobox transcription factor OsWOX4 controls the primary root elongation by activating OsAUX1 in rice.
- Silencing of OsWOX4 by RNA interference (RNAi) greatly increased the primary root length, whereas its overexpression reduced primary root elongation significantly.
- Collectively, our results indicated that OsWOX4 played a crucial role in the primary root elongation by regulating auxin transport, suggesting its importance in rice root system architecture.
- The expression of genes responsible for auxin biosynthesis and transport was also changed in OsWOX4 transgenic lines.
- Further analysis showed that the accumulation of free IAA was slightly increased in RNAi roots, but drastically reduced in plants overexpressing OsWOX4.
Functional Keywords
- leaf , vascular-bundle , stem , leaf-development , shoot , development , cytokinin , meristem , cell-cycle , cell-proliferation , shoot-apical-meristem , transcription-factor , root , auxin , root-elongation , architecture , iaa , auxin-transport , primary-root , IAA , auxin-biosynthesis , root-length , root-system-architecture
Literature and News
- WUSCHEL-RELATED HOMEOBOX4 is involved in meristem maintenance and is negatively regulated by the CLE gene FCP1 in rice . DOI: 10.1105/tpc.112.103432 ; PMID: 23371950
- WUSCHEL-RELATED HOMEOBOX4 acts as a key regulator in early leaf development in rice . DOI: 10.1371/journal.pgen.1007365 ; PMID: 29684018
- The WUSCHEL-related homeobox transcription factor OsWOX4 controls the primary root elongation by activating OsAUX1 in rice . DOI: 10.1016/j.plantsci.2020.110575 ; PMID: 32771139
Gene Resources
- UniProt: F6MIV6
- EMBL: JF836159
- AlphaFoldDB: F6MIV6
- EnsemblPlants: Os04t0649400-01
- Gramene: Os04t0649400-01
- InterPro: IPR001356, IPR009057, IPR044186
- PANTHER: PTHR47716, PTHR47716:SF1
Sequences
cDNA Sequence
- >LOC_Os04g55590.1
ATGAGGCTTCACCATCTGCATGTGGCCTACCTGGATCACAAAGCGTCGTCGTCCTCGTCGTCTCCGGCGCCACCATCCATCTCCCCGTCGTCGATCCCCGGATCGGCCGCCTTCCCTGCTTTCTCCTTCAAATGCCTCCGCCCGCTCGCGCCCAAGATCTCGCTGCCGGAGCCGAGGAAGATGATCGCGCCGCCGGACTTCGTCGTCCCTCGCGCCAGAAACGCTTCCAAGCTGCTCAACTACACTGTGCAGGTGCCGGCGGCGGGGACGACGAGGTGGAACCCGTCGGCGGAGCAGATAAAGGTGCTGGAGATGCTGTACCGCGGCGGGATGCGGACGCCGAACTCCGTCCAGATCGAGCGGATCACGGAGGAGCTCGGCAAGTACGGCCGGATCGAGGGCAAGAACGTCTTCTACTGGTTCCAGAATCACAAGGCCCGCGAGCGCCAGAAGCAGAAGCGCGCCGCCCTCCTCACCCTCAGCACGCTCGACCCTTCCTTGCTGCCCGCTACCGCTAACGAAACCAAAGAGGCACCGGAGAAGAAGGAGAAGGACGTGGAAGATGGATTGGCGAGCTGCAAGCGGCGGTGCAAGGCGTGGGGTGACGGCGCCGGCGATGGAGACGCGGTGGTGGCGACGGAGGCGGCCGGCGGCTGCACCGACGAAGTGACCCTGGAGCTCTTCCCGTTGCATCCCCAGGGAAAAGCTTAA
CDS Sequence
- >LOC_Os04g55590.1
ATGAGGCTTCACCATCTGCATGTGGCCTACCTGGATCACAAAGCGTCGTCGTCCTCGTCGTCTCCGGCGCCACCATCCATCTCCCCGTCGTCGATCCCCGGATCGGCCGCCTTCCCTGCTTTCTCCTTCAAATGCCTCCGCCCGCTCGCGCCCAAGATCTCGCTGCCGGAGCCGAGGAAGATGATCGCGCCGCCGGACTTCGTCGTCCCTCGCGCCAGAAACGCTTCCAAGCTGCTCAACTACACTGTGCAGGTGCCGGCGGCGGGGACGACGAGGTGGAACCCGTCGGCGGAGCAGATAAAGGTGCTGGAGATGCTGTACCGCGGCGGGATGCGGACGCCGAACTCCGTCCAGATCGAGCGGATCACGGAGGAGCTCGGCAAGTACGGCCGGATCGAGGGCAAGAACGTCTTCTACTGGTTCCAGAATCACAAGGCCCGCGAGCGCCAGAAGCAGAAGCGCGCCGCCCTCCTCACCCTCAGCACGCTCGACCCTTCCTTGCTGCCCGCTACCGCTAACGAAACCAAAGAGGCACCGGAGAAGAAGGAGAAGGACGTGGAAGATGGATTGGCGAGCTGCAAGCGGCGGTGCAAGGCGTGGGGTGACGGCGCCGGCGATGGAGACGCGGTGGTGGCGACGGAGGCGGCCGGCGGCTGCACCGACGAAGTGACCCTGGAGCTCTTCCCGTTGCATCCCCAGGGAAAAGCTTAA
Protein Sequence
- >LOC_Os04g55590.1
MRLHHLHVAYLDHKASSSSSSPAPPSISPSSIPGSAAFPAFSFKCLRPLAPKISLPEPRKMIAPPDFVVPRARNASKLLNYTVQVPAAGTTRWNPSAEQIKVLEMLYRGGMRTPNSVQIERITEELGKYGRIEGKNVFYWFQNHKARERQKQKRAALLTLSTLDPSLLPATANETKEAPEKKEKDVEDGLASCKRRCKAWGDGAGDGDAVVATEAAGGCTDEVTLELFPLHPQGKA*