Information report for GIF1;OsCIN2
Gene Details
|
|
Functional Descriptions
- We previously demonstrated that the rice cell-wall invertase (CWI) gene GIF1 that plays an important role in the grain-filling process was most likely subjected to domestication selection in the promoter region.
- Results based on analyses of population genetics and gene phylogenetic tree of 25 cultivars and 25 wild rice sequences demonstrated that OsCIN1 was also artificially selected during rice domestication with a fixed mutation in the coding region, in contrast to GIF1 that was selected in the promoter region.
- Duplication and independent selection of cell-wall invertase genes GIF1 and OsCIN1 during rice evolution and domestication.
- Here we report the isolation and functional analysis of the rice GIF1 (GRAIN INCOMPLETE FILLING 1) gene that encodes a cell-wall invertase required for carbon partitioning during early grain-filling.
- The cultivated GIF1 gene shows a restricted expression pattern during grain-filling compared to the wild rice allele, probably a result of accumulated mutations in the gene’s regulatory sequence through domestication.
- Fine mapping with introgression lines revealed that the wild rice GIF1 is responsible for grain weight reduction.
- Ectopic expression of the cultivated GIF1 gene with the 35S or rice Waxy promoter resulted in smaller grains, whereas overexpression of GIF1 driven by its native promoter increased grain production.
- Taken together, our study reveals that sugar homeostasis mediated by GIF1 plays an important role in constitutive and induced physical and chemical defence.
- Sugar homeostasis mediated by cell wall invertase GRAIN INCOMPLETE FILLING 1 (GIF1) plays a role in pre-existing and induced defence in rice.
- These findings, together with the domestication signature that we identified by comparing nucleotide diversity of the GIF1 loci between cultivated and wild rice, strongly suggest that GIF1 is a potential domestication gene and that such a domestication-selected gene can be used for further crop improvement.
- In this study, we observed that the grains of GIF1, a loss-of-function mutant of the cell wall invertase gene GRAIN INCOMPLETE FILLING 1 (GIF1), were hypersusceptible to postharvest fungal pathogens, with decreased levels of sugars and a thinner glume cell wall in comparison with the wild-type.
- Moreover, the cell wall was much thicker in the infection sites of the GIF1-OE plants when compared with the wild-type plants.
- We previously showed that upregulation of OsGIF1 expression improves rice grain size.
- Overexpression and functional knock-out via a CRISPR/Cas9 strategy revealed that OsGIF1 not only positively regulates the sizes of rice leaf, stem, and grain but also influences rice reproduction.
- Expression profiles based on both qRT-PCR and GUS (
-glucuronidase) histochemical staining suggested that OsGIF1 is differentially expressed across various rice tissues, consistent with its roles in regulating the development of multiple rice organs. - Our results suggest that OsGIF1 plays important roles in vegetative and reproductive developmental processes, with important implications for rice breeding.
- Here, we report pleiotropic effects of OsGIF1 on rice organ size regulation.
- Further histological analysis suggested that OsGIF1 affected rice organ size possibly by regulating cell size.
- Representative of the white-belly phenotype, grains of WB1 showed a higher grain chalkiness rate and degree and a lower 1000-grain weight (decreased by ~34%), in comparison with that of Wild Type (WT).
- Nipponbare demonstrates that WB1 regulates endosperm development and that different mutations of WB1 disrupt its biological function.
- The WB1 mutant develops a white-belly endosperm and abnormal starch granules in the inner portion of white grains.
- Here, we report the isolation and characterization of a recessive mutation of White Belly 1 (WB1), which regulates rice endosperm development, using a modified MutMap method in the rice mutant WB1.
- Transcript levels analysis of all candidate genes showed that WB1 (Os04t0413500), encoding a cell-wall invertase, was the most probable cause of white-belly endosperm phenotype.
Functional Keywords
Literature and News
- Duplication and independent selection of cell-wall invertase genes GIF1 and OsCIN1 during rice evolution and domestication . DOI: 10.1186/1471-2148-10-108 ; PMID: 20416079
- Sugar homeostasis mediated by cell wall invertase GRAIN INCOMPLETE FILLING 1 (GIF1) plays a role in pre-existing and induced defence in rice . DOI: 10.1111/mpp.12078 ; PMID: 24118770
- Control of rice grain-filling and yield by a gene with a potential signature of domestication . DOI: 10.1038/ng.220 ; PMID: 18820698
- OsGIF1 Positively Regulates the Sizes of Stems, Leaves, and Grains in Rice . DOI: 10.3389/fpls.2017.01730 ; PMID: 29051769
- WB1, a Regulator of Endosperm Development in Rice, Is Identified by a Modified MutMap Method . DOI: 10.3390/ijms19082159 ; PMID: 30042352
Sequences
cDNA Sequence
- >LOC_Os04g33740.1
ATCCTCCTCTCCTCTTCTCGCTCTCACTTCTTGTGCCCAAGTGTGAGAGCAATGGGAGTTCTTGGTAGTAGGGTCGCTTGGGCATGGCTGGTCCAGCTGCTGCTGCTCCAGCAGCTCGCCGGAGCGTCGCACGTCGTCTACGACGACCTCGAGCTGCAGGCGGCTGCTACCACAGCGGACGGCGTGCCGCCGTCCATCGTCGACTCTGAGCTCCGGACTGGGTATCACTTCCAGCCACCCAAGAACTGGATCAATGGTAATGCGCCGATGTACTACAAGGGGTGGTACCATCTGTTCTACCAGTACAACCCCAAGGGCGCCGTGTGGGGGAACATCGTGTGGGCGCACTCAGTGTCACGTGACCTCATCAACTGGGTGGCGCTCAAGCCGGCCATCGAGCCCAGCATCAGGGCCGACAAGTACGGCTGCTGGTCGGGGTCGGCGACGATGATGGCCGACGGGACGCCGGTGATCATGTACACCGGCGTCAACCGCCCCGACGTCAACTACCAGGTGCAGAACGTGGCGCTGCCGAGGAACGGGTCGGACCCGCTGCTGCGCGAGTGGGTGAAGCCCGGCCACAACCCGGTGATCGTGCCCGAGGGCGGCATCAACGCGACGCAGTTCCGCGACCCGACCACCGCGTGGCGCGGGGCCGACGGCCACTGGCGGCTGCTCGTCGGCAGCCTCGCGGGGCAGTCCCGCGGCGTGGCGTACGTGTACCGGAGCAGGGACTTCCGGCGGTGGACGCGCGCGGCGCAGCCGCTGCACTCGGCGCCCACGGGGATGTGGGAGTGCCCGGACTTCTACCCGGTCACCGCGGACGGCCGCCGCGAGGGCGTCGACACCTCGTCCGCCGTCGTCGACGCCGCCGCCTCGGCGCGCGTCAAGTACGTGCTCAAGAACAGCCTCGACCTGCGCCGGTACGACTACTACACCGTCGGAACGTACGACCGGAAGGCCGAGCGGTACGTGCCGGACGACCCCGCCGGCGACGAGCACCACATCCGCTACGACTACGGCAACTTCTACGCCTCCAAGACGTTCTACGACCCGGCGAAGCGCCGCCGCATCCTCTGGGGATGGGCCAACGAGTCCGACACCGCCGCCGACGACGTGGCCAAGGGCTGGGCCGGAATCCAGGCGATTCCGAGGAAAGTGTGGCTGGACCCAAGTGGGAAGCAACTGTTGCAGTGGCCAATCGAGGAGGTCGAGAGGCTGAGAGGGAAGTGGCCGGTCATTCTCAAGGACAGGGTGGTCAAGCCAGGGGAACACGTCGAGGTGACCGGGCTACAAACTGCACAGGCTGACGTGGAGGTGAGCTTCGAGGTGGGGAGCCTGGAGGCGGCGGAGCGGCTGGACCCGGCGATGGCGTACGACGCGCAGCGGCTGTGCAGCGCGCGGGGCGCCGACGCGAGGGGCGGCGTGGGGCCGTTCGGCCTGTGGGTGCTCGCGTCCGCGGGGCTGGAGGAGAAGACCGCCGTGTTCTTCAGGGTGTTCAGGCCGGCGGCGCGCGGCGGCGGCGCCGGCAAGCCCGTCGTGCTCATGTGCACCGACCCCACCAAGTCATCGCGCAACCCGAACATGTACCAGCCGACGTTTGCAGGGTTCGTTGACACGGACATCACCAACGGGAAGATATCTCTGAGGAGCCTGATCGACAGGTCGGTTGTTGAGAGCTTCGGGGCTGGAGGAAAGGCGTGCATCCTGTCGAGGGTGTACCCGTCGCTGGCCATCGGCAAGAACGCGCGCCTTTACGTTTTCAATAACGGGAAGGCGGAGATCAAGGTGTCGCAGCTCACCGCGTGGGAGATGAAGAAGCCGGTCATGATGAATGGAGCCTAAACAATATTTGAAATTGAGAGAGATAGATGCAATGCATGATGAGAACTACCTTCAGTAGCTAGCTAGATTTTTGAGTTTCAGCGGAAAAGAAAAAACTGATTGCCCTTAATTATGTGCTAAATCATGCCCCCTTGTGTAAAATGGTTTCAGTCACACGTGTCGTATGCATATGTACCAAGGGGACAGTTTGAATGCATGGATGCCATTAGGACTAATAAAGATTGATGCTAGTATAACCCATGAGTGCGCACTGGTGTTAGATGCACTCCGGTTGCTTTATTTGTCTTAAGATATCATCTTTCAATGCATAGACCAGACCACTGATATACCAGAATATCTGAATTTTTTTTATGTGTAAGTGTAATCACTGGATTTGTCCC
CDS Sequence
- >LOC_Os04g33740.1
ATGGGAGTTCTTGGTAGTAGGGTCGCTTGGGCATGGCTGGTCCAGCTGCTGCTGCTCCAGCAGCTCGCCGGAGCGTCGCACGTCGTCTACGACGACCTCGAGCTGCAGGCGGCTGCTACCACAGCGGACGGCGTGCCGCCGTCCATCGTCGACTCTGAGCTCCGGACTGGGTATCACTTCCAGCCACCCAAGAACTGGATCAATGGTAATGCGCCGATGTACTACAAGGGGTGGTACCATCTGTTCTACCAGTACAACCCCAAGGGCGCCGTGTGGGGGAACATCGTGTGGGCGCACTCAGTGTCACGTGACCTCATCAACTGGGTGGCGCTCAAGCCGGCCATCGAGCCCAGCATCAGGGCCGACAAGTACGGCTGCTGGTCGGGGTCGGCGACGATGATGGCCGACGGGACGCCGGTGATCATGTACACCGGCGTCAACCGCCCCGACGTCAACTACCAGGTGCAGAACGTGGCGCTGCCGAGGAACGGGTCGGACCCGCTGCTGCGCGAGTGGGTGAAGCCCGGCCACAACCCGGTGATCGTGCCCGAGGGCGGCATCAACGCGACGCAGTTCCGCGACCCGACCACCGCGTGGCGCGGGGCCGACGGCCACTGGCGGCTGCTCGTCGGCAGCCTCGCGGGGCAGTCCCGCGGCGTGGCGTACGTGTACCGGAGCAGGGACTTCCGGCGGTGGACGCGCGCGGCGCAGCCGCTGCACTCGGCGCCCACGGGGATGTGGGAGTGCCCGGACTTCTACCCGGTCACCGCGGACGGCCGCCGCGAGGGCGTCGACACCTCGTCCGCCGTCGTCGACGCCGCCGCCTCGGCGCGCGTCAAGTACGTGCTCAAGAACAGCCTCGACCTGCGCCGGTACGACTACTACACCGTCGGAACGTACGACCGGAAGGCCGAGCGGTACGTGCCGGACGACCCCGCCGGCGACGAGCACCACATCCGCTACGACTACGGCAACTTCTACGCCTCCAAGACGTTCTACGACCCGGCGAAGCGCCGCCGCATCCTCTGGGGATGGGCCAACGAGTCCGACACCGCCGCCGACGACGTGGCCAAGGGCTGGGCCGGAATCCAGGCGATTCCGAGGAAAGTGTGGCTGGACCCAAGTGGGAAGCAACTGTTGCAGTGGCCAATCGAGGAGGTCGAGAGGCTGAGAGGGAAGTGGCCGGTCATTCTCAAGGACAGGGTGGTCAAGCCAGGGGAACACGTCGAGGTGACCGGGCTACAAACTGCACAGGCTGACGTGGAGGTGAGCTTCGAGGTGGGGAGCCTGGAGGCGGCGGAGCGGCTGGACCCGGCGATGGCGTACGACGCGCAGCGGCTGTGCAGCGCGCGGGGCGCCGACGCGAGGGGCGGCGTGGGGCCGTTCGGCCTGTGGGTGCTCGCGTCCGCGGGGCTGGAGGAGAAGACCGCCGTGTTCTTCAGGGTGTTCAGGCCGGCGGCGCGCGGCGGCGGCGCCGGCAAGCCCGTCGTGCTCATGTGCACCGACCCCACCAAGTCATCGCGCAACCCGAACATGTACCAGCCGACGTTTGCAGGGTTCGTTGACACGGACATCACCAACGGGAAGATATCTCTGAGGAGCCTGATCGACAGGTCGGTTGTTGAGAGCTTCGGGGCTGGAGGAAAGGCGTGCATCCTGTCGAGGGTGTACCCGTCGCTGGCCATCGGCAAGAACGCGCGCCTTTACGTTTTCAATAACGGGAAGGCGGAGATCAAGGTGTCGCAGCTCACCGCGTGGGAGATGAAGAAGCCGGTCATGATGAATGGAGCCTAA
Protein Sequence
- >LOC_Os04g33740.1
MGVLGSRVAWAWLVQLLLLQQLAGASHVVYDDLELQAAATTADGVPPSIVDSELRTGYHFQPPKNWINGNAPMYYKGWYHLFYQYNPKGAVWGNIVWAHSVSRDLINWVALKPAIEPSIRADKYGCWSGSATMMADGTPVIMYTGVNRPDVNYQVQNVALPRNGSDPLLREWVKPGHNPVIVPEGGINATQFRDPTTAWRGADGHWRLLVGSLAGQSRGVAYVYRSRDFRRWTRAAQPLHSAPTGMWECPDFYPVTADGRREGVDTSSAVVDAAASARVKYVLKNSLDLRRYDYYTVGTYDRKAERYVPDDPAGDEHHIRYDYGNFYASKTFYDPAKRRRILWGWANESDTAADDVAKGWAGIQAIPRKVWLDPSGKQLLQWPIEEVERLRGKWPVILKDRVVKPGEHVEVTGLQTAQADVEVSFEVGSLEAAERLDPAMAYDAQRLCSARGADARGGVGPFGLWVLASAGLEEKTAVFFRVFRPAARGGGAGKPVVLMCTDPTKSSRNPNMYQPTFAGFVDTDITNGKISLRSLIDRSVVESFGAGGKACILSRVYPSLAIGKNARLYVFNNGKAEIKVSQLTAWEMKKPVMMNGA*