Information report for OsMADS25
Gene Details
|
|
Functional Descriptions
- MADS-box Transcription Factor OsMADS25 Regulates Root Development through Affection of Nitrate Accumulation in Rice.
- Over-expression of OsMADS25 significantly promoted lateral and primary root growth as well as shoot growth in a nitrate-dependent manner in Arabidopsis.
- OsMADS25 overexpression in transgenic rice resulted in significantly increased primary root length, lateral root number, lateral root length and shoot fresh weight in the presence of nitrate.
- Down-regulation of OsMADS25 in transgenic rice exhibited significantly reduced shoot and root growth in the presence of nitrate.
- Taken together, our findings suggest that OsMADS25 is a positive regulator control lateral and primary root development in rice.
- Furthermore, over-expression of OsMADS25 in transgenic rice promoted nitrate accumulation and significantly increased the expressions of nitrate transporter genes at high rates of nitrate supply while down-regulation of OsMADS25 produced the opposite effect.
- Our results showed that OsMADS25 protein was found in the nucleus as well as in the cytoplasm.
- Here we have investigated the role of OsMADS25 in the plant’s responses to external nitrate in Oryza Sativa.
- OsMADS25 overexpression in transgenic rice resulted in significantly increased primary root length, lateral root number, lateral root length and shoot fresh weight in the presence of nitrate.
- OsMADS25 regulates root system development via auxin signaling in rice.
- In spite of recent progress, the molecular mechanisms underlying the regulation of root development by OsMADS25 are not well known.
- It is unclear whether OsMADS25 regulates root development via auxin signaling.
- In this study, we examined the role of OsMADS25 in root development and characterized the signaling pathway through which OsMADS25 regulates root system development in rice.
- OsMADS25 overexpression significantly increased, but RNAi gene silencing repressed primary root (PR) length and lateral root (LR) density.
- Further study showed that OsMADS25 increased auxin accumulation in the root system by enhancing auxin biosynthesis and transport, while also reducing auxin degradation, thus stimulating root development.
- Therefore, our findings reveal a molecular mechanism by which OsMADS25 modulates root system growth and development in rice, at least partilly, via Aux/IAA-based auxin signaling.
- Moreover, OsMADS25 promoted LR development in response to NO3-.
- More importantly, OsMADS25 was found to regulate OsIAA14 expression directly by binding to the CArG-box in the promoter region of OsIAA14, which encodes an Aux/IAA transcriptional repressor of auxin signaling.
- Rice transcription factor OsMADS25 modulates root growth and confers salinity tolerance via the ABA-mediated regulatory pathway and ROS scavenging.
- In this study, we describe that OsMADS25 is required for the root growth as well as salinity tolerance, via maintaining ROS homeostasis in rice (Oryza sativa).
- Overexpression of OsMADS25 remarkably enhanced the primary root (PR) length and lateral root (LR) density, whereas RNAi silence of this gene reduced PR elongation significantly, with altered ROS accumulation in the root tip.
- Interestingly, overexpression of OsMADS25 raised the root sensitivity to exogenous ABA, and the expression of ABA-dependent stress-responsive genes was elevated greatly in overexpression plants under salinity stress.
- Taken together, our findings reveal that OsMADS25 might be an important transcriptional regulator that regulates the root growth and confers salinity tolerance in rice via the ABA-mediated regulatory pathway and ROS scavenging.
- Expectedly, overexpression of OsMADS25 significantly enhanced the tolerance to salinity and oxidative stress in rice plants, with the elevated activity of antioxidant enzymes, increased accumulation of osmoprotective solute proline and reduced frequency of open stoma.
- In addition, OsMADS25 seemed to promote auxin signaling by activating OsYUC4 transcription.
Functional Keywords
- root , growth , shoot , development , transcription-factor , transporter , lateral-root , primary-root , root-development , cytoplasm , nitrate , nucleus , nitrate-transporter , root-length , root-number , lateral-root-number , lateral-root-length , auxin , auxin-biosynthesis , oxidative-stress , salinity , tolerance , oxidative , stress , salinity-stress , homeostasis , transcriptional-regulator
Literature and News
- MADS-box transcription factor OsMADS25 regulates root development through affection of nitrate accumulation in rice . DOI: 10.1371/journal.pone.0135196 ; PMID: 26258667
- OsMADS25 regulates root system development via auxin signalling in rice . DOI: 10.1111/tpj.14007 ; PMID: 29932274
- Rice transcription factor OsMADS25 modulates root growth and confers salinity tolerance via the ABA-mediated regulatory pathway and ROS scavenging . DOI: 10.1371/journal.pgen.1007662 ; PMID: 30303953
- Comparative transcriptome profile analysis of rice varieties with different tolerance to zinc deficiency . DOI: 10.1111/plb.13227 ; PMID: 33296551
Gene Resources
- UniProt: Q84NC5
- EMBL: AK102927, AL731609, AP008210
- AlphaFoldDB: Q84NC5
- EnsemblPlants: Os04t0304400-01
- Gramene: Os04t0304400-01
- KEGG: dosa:Os04g0304400
- Orthologous matrix: FWQREVT
- InterPro: IPR002100, IPR002487, IPR033896
Homologs
- Triticum aestivum: Traes_7AS_8123257BA.1
Sequences
cDNA Sequence
- >LOC_Os04g23910.1
GCTATACGCATCTTCCCTAGCTTGCTAAGCTAGCTAGTCTTCTCCTTCCTTTCTCCTCTTCCTCCTCCTCCTCTTCTTCTCAATCTTGCTCAGCAAATCTTGTCGGGGAGAGAGAGAGAGAGATCAGCAAGGAGAAGAGGGAATTAAGCTAGATCGAGGTAGTCGTCGATCGATCGATTGAAGATGGGGAGAGGGAAGATTGCCATCAAGAGGATCGACAACACGATGAACCGGCAGGTGACCTTCTCGAAGCGGCGCGGCGGGCTGATGAAGAAGGCCCGGGAGCTGGCCATCCTCTGCGACGCCGACGTCGGCCTCATTGTCTTCTCCTGCACCGGCCGCCTCTACGACTTCTCCAGCTCAAGCATGAAATCAATAATAGAGCGGTACCAGGAGGCAGGAGAGGAGCATTGTCGGTTGCTGAACCCAATGTCAGAGGCTAAGTTTTGGCAGCGGGAGGTTACAACTTTGAGGCAGCAAGTGCAAAACTTACACCACAACAACAGGCAACTTTTGGGAGAGGAAATCTCCAACTTCACAGTTAGAGATCTGCAGCTTCTCCAGAACCAAGTTGAGATGAGCCTACATTCCATAAGAAATAAAAAGGATCAACTTTTGGCAGAGGAGATTCTAAAACTCAATGAAAAGGGGTCTCTTGTTCAAAAGGAGAACAGTGAACTTCGCAAGAAGTTCAACATTGCTCATCAACGCAACATAGAATTACACAAGAAGCTTAACTCTGGAGAAAGCACGTCAAGTGAGCAAGTTACCAGAAGCTCAAAGGATCCCGGAGAATCGAGTACACCCCGTGATTCACGTGTGTGTATTGACCTTGAATTGAGTCAAAAAGAAGTTGAAGATGAATAACACATGATCAAGTGTTAAAAACAACATGATGGCCAGTAACTTTTGCAGCATCACGCCTACTACAAGCGCAAGAAAAGCTAGCTACTACTGGAACAAGGGATCTTAATCATGTTTTGAAACTTAATTAGTAATATTTTAAAAAATCGTACTATACTAATCATGATGTGTAGCGTATTGCACCACTGAATTTATTACTGTAATTAACATGGTGAGTGTTAAAATATTTTGTGATATC
CDS Sequence
- >LOC_Os04g23910.1
ATGGGGAGAGGGAAGATTGCCATCAAGAGGATCGACAACACGATGAACCGGCAGGTGACCTTCTCGAAGCGGCGCGGCGGGCTGATGAAGAAGGCCCGGGAGCTGGCCATCCTCTGCGACGCCGACGTCGGCCTCATTGTCTTCTCCTGCACCGGCCGCCTCTACGACTTCTCCAGCTCAAGCATGAAATCAATAATAGAGCGGTACCAGGAGGCAGGAGAGGAGCATTGTCGGTTGCTGAACCCAATGTCAGAGGCTAAGTTTTGGCAGCGGGAGGTTACAACTTTGAGGCAGCAAGTGCAAAACTTACACCACAACAACAGGCAACTTTTGGGAGAGGAAATCTCCAACTTCACAGTTAGAGATCTGCAGCTTCTCCAGAACCAAGTTGAGATGAGCCTACATTCCATAAGAAATAAAAAGGATCAACTTTTGGCAGAGGAGATTCTAAAACTCAATGAAAAGGGGTCTCTTGTTCAAAAGGAGAACAGTGAACTTCGCAAGAAGTTCAACATTGCTCATCAACGCAACATAGAATTACACAAGAAGCTTAACTCTGGAGAAAGCACGTCAAGTGAGCAAGTTACCAGAAGCTCAAAGGATCCCGGAGAATCGAGTACACCCCGTGATTCACGTGTGTGTATTGACCTTGAATTGAGTCAAAAAGAAGTTGAAGATGAATAA
Protein Sequence
- >LOC_Os04g23910.1
MGRGKIAIKRIDNTMNRQVTFSKRRGGLMKKARELAILCDADVGLIVFSCTGRLYDFSSSSMKSIIERYQEAGEEHCRLLNPMSEAKFWQREVTTLRQQVQNLHHNNRQLLGEEISNFTVRDLQLLQNQVEMSLHSIRNKKDQLLAEEILKLNEKGSLVQKENSELRKKFNIAHQRNIELHKKLNSGESTSSEQVTRSSKDPGESSTPRDSRVCIDLELSQKEVEDE*