Gene Details:
- MSU gene ID: LOC_Os03g57240
- RAPdb gene ID: Os03g0786400
- Gene Symbol: DST WL1 HST1
- Genome: MSU7 , IRGSP-1.0
- Species: Oryza sativa
Functional Descriptions:
- Here, we clone and characterize DST (drought and salt tolerance)-a previously unknown zinc finger transcription factor that negatively regulates stomatal closure by direct modulation of genes related to H(2)O(2) homeostasis-and identify a novel pathway for the signal transduction of DST-mediated H(2)O(2)-induced stomatal closure.
- Loss of DST function increases stomatal closure and reduces stomatal density, consequently resulting in enhanced drought and salt tolerance in rice.
- A previously unknown zinc finger protein, DST, regulates drought and salt tolerance in rice via stomatal aperture control.
- We identify that DST(reg1), a semidominant allele of the DST gene, perturbs DST-directed regulation of OsCKX2 expression and elevates CK levels in the reproductive SAM, leading to increased meristem activity, enhanced panicle branching, and a consequent increase of grain number.
- Here, we report that the zinc finger transcription factor DROUGHT AND SALT TOLERANCE (DST) directly regulates OsCKX2 expression in the reproductive meristem.
- Our study reveals that, as a unique regulator of reproductive meristem activity, DST may be explored to facilitate the genetic enhancement of grain production in rice and other small grain cereals.
- Importantly, the DST(reg1) allele provides an approach to pyramid the Gn1a-dependent and Gn1a-independent effects on grain production.
- Rice zinc finger protein DST enhances grain production through controlling Gn1a/OsCKX2 expression.
- DST-directed expression of OsCKX2 regulates CK accumulation in the SAM and, therefore, controls the number of the reproductive organs.
- The results suggest that OsSRO1c has dual roles in drought and oxidative stress tolerance of rice by promoting stomatal closure and H(2)O(2) accumulation through a novel pathway involving regulators SNAC1 and DST.
- Expression of DST, a reported zinc finger gene negatively regulating H(2)O(2)-induced stomatal closure, and the activity of H(2)O(2)-scavenging related enzymes were significantly suppressed, and H(2)O(2) in guard cells was accumulated in the overexpression lines.
- Plasma membrane receptor-like kinase leaf panicle 2 acts downstream of the DROUGHT AND SALT TOLERANCE transcription factor to regulate drought sensitivity in rice.
- Mediator complex subunit MED25 physically interacts with DST to regulate spikelet number in rice.
- Phenotypic analyses revealed that OsMED25-RNAi and the osmed25 mutant plants exhibited enlarged panicles, with enhanced branching and spikelet number, similar to the DST mutant.
- Thus, OsMED25 was involved in the communication between DST and Pol II general transcriptional machinery to regulate spikelet number.
- Interestingly, we found that WL1 negatively regulated the expression of a narrow leaf gene, NARROW LEAF 1 (NAL1), by recruiting the co-repressor TOPLESS-RELATED PROTEIN and directly binding to the NAL1 regulatory region to inhibit its expression by reducing the chromatin histone acetylation.
- WL1 encodes a Cys-2/His-2-type (C2H2) zinc finger protein that interacts with Tillering and Dwarf 1 (TAD1), a co-activator of the anaphase-promoting complex/cyclosome (APC/C) (a multi-subunit E3 ligase).
Function-related keywords:
- salt-tolerance , grain-number , meristem , salt , stomatal , grain , reproductive , drought , oxidative , branching , stomata , transcription-factor , panicle , homeostasis , drought-sensitivity , spikelet , spikelet-number , leaf , tillering , R-protein , zinc , dwarf
Literature:
- The SNAC1-targeted gene OsSRO1c modulates stomatal closure and oxidative stress tolerance by regulating hydrogen peroxide in rice . DOI: 10.1093/jxb/ers349 ; PMID: 23202132
- A previously unknown zinc finger protein, DST, regulates drought and salt tolerance in rice via stomatal aperture control . DOI: 10.1101/gad.1812409 ; PMID: 19651988
- Rice zinc finger protein DST enhances grain production through controlling Gn1a/OsCKX2 expression . DOI: 10.1073/pnas.1300359110 ; PMID: 23382237
- Plasma membrane receptor-like kinase leaf panicle 2 acts downstream of the DROUGHT AND SALT TOLERANCE transcription factor to regulate drought sensitivity in rice . DOI: 10.1093/jxb/eru417 ; PMID: 25385766
- Overexpression of a Chimeric Gene, OsDST-SRDX, Improved Salt Tolerance of Perennial Ryegrass . DOI: 10.1038/srep27320 ; PMID: 27251327
- Mediator complex subunit MED25 physically interacts with DST to regulate spikelet number in rice . DOI: 10.1111/jipb.13238 ; PMID: 35212455
- The APC/CTAD1-WIDE LEAF 1-NARROW LEAF 1 pathway controls leaf width in rice . DOI: 10.1093/plcell/koac232 ; PMID: 35904763
Related News:
Gene Resources:
- NCBI ID: GQ178286
- UniProt accessions:
Sequences:
cDNA Sequence
- >LOC_Os03g57240.1
CCCCTGACCCCAACCCCAAACCCACTCTACTCTACTGTGCCTCACCTCTTGCCACTACTATTTCTAGTAGTCGTGTATCATCATTTCAGATATCATATCGCCACCTCTCGTTTTTTTAATAATATCAGCGGCGAGCGAGCGAGATGGACTCCCCGTCGCCTATGGCGGCGCAGGCGGCCGACCTGTCGCTGACGCTGGCGCCGTCGGGAGGGGGTGGTGGGGGAGGAGGAGGCGGCGGCGGTGGTGGGTCGTCGTCGGCGTGCATCGACGGCAAGGACGTGCGGCTGTTCCCGTGCTTGTTCTGCAACAAGAAGTTCTTGAAGTCGCAGGCGCTGGGCGGGCACCAGAACGCGCACAAGAAGGAGCGGAGCATCGGGTGGAATCCCTACTTCTACATGCCGCCGACGCCGCACCCCGCCGGCAATGCCGCCGCCGCCGCCGCGGCGGCGACGCCCGGTGGGATGTCGTCCGTCACGACGCCATCCGGGAGCTACGGCGTCGTCGGTGGTGCCGCCGTCGGGGCTACTGCTGGCGTTGGGGGCGGAGGTGGAGTGGGAGGGGGGCTTCTCCCGGCGCACGCGTACGCCGGGCACGGGTACGCCGCGGTGCCGACGTCGTTCCCCATCGCGTCGCACAGCTCGAGCGTGGTTGGCTCCGGTGGGCTGCAGTACTACGCTGGTACCGACTGCGGCGCGGCGGCGGCGGGTGCGGCGAAGACGACGACGACGGCGGCGGCGGCGGCGACGGCCGTGGCGGGGAGCGAGAGCGGCGTGCAGGTGCCCCGGTTCGCGACGCACCAGCACCATCTCCTGGCGGTGGTGAGCAGCGGGCGCGCGATGCTGGCGGCGCCCGACCAGCCGGGCGCCGGGCGCGACGACATGATCGACATGCTCAACTGGAGGCGAGGCTCCCACGGCCCCACCGCCTCCGCCGCCGCCACCACGCCCTCCCCGGCAAGCACCACCACCACGCTCACCACCTTCGCCAGCGCCGACGGCAGCAACAACGGCGAGGAGAACGAGGAGCTCGACCTCAACTTGAGCCTCTAGCTCCCACCACCACCACCTCCTCCTCCGCCGCCGCCGCCGCCGCCGCGCAATCCAAGAAGGCAAGGTCAATCAATCGCCATGTTCTTCTTCTCCAAGCTCCACCTACTCCTCTTCCAATTCCTCCTCGTGTGTGATTAATCCCCCTCTTCTTGCTGCCTGCGTACGTACTCCTTAATTAATTAGCTCTTAGGGACGTTAATTAATCTCAGTTCTTGGCTCTCTTCTCCTCTCCTCTCCTCTCCTCTCATCTCACTTGTATGTTAATGTTAGTACTCCTTGTAATCGATCAATCAGTCCTCTTTTTTTGCATCCTTTTTTGTCTTCTTTTTCATTTTGCCGTCGATTTCTTGGCTTCTCTCTTCATTTTACCTTTCATGTTTGCCTCTGCTGCTGTATATATCTGTGACTGTCTCTGTAGTCTGTACTTGGATGGCACTTGCAACCAACCGCATTGCAATGGCCTGCAGAGGCTCGATGGTCACACTGTTCATCTCATGCTCGAATCGCCATTGACATGTCCATCTACTTCTACTTCTTCTCATCGTAT
CDS Sequence
- >LOC_Os03g57240.1
ATGGACTCCCCGTCGCCTATGGCGGCGCAGGCGGCCGACCTGTCGCTGACGCTGGCGCCGTCGGGAGGGGGTGGTGGGGGAGGAGGAGGCGGCGGCGGTGGTGGGTCGTCGTCGGCGTGCATCGACGGCAAGGACGTGCGGCTGTTCCCGTGCTTGTTCTGCAACAAGAAGTTCTTGAAGTCGCAGGCGCTGGGCGGGCACCAGAACGCGCACAAGAAGGAGCGGAGCATCGGGTGGAATCCCTACTTCTACATGCCGCCGACGCCGCACCCCGCCGGCAATGCCGCCGCCGCCGCCGCGGCGGCGACGCCCGGTGGGATGTCGTCCGTCACGACGCCATCCGGGAGCTACGGCGTCGTCGGTGGTGCCGCCGTCGGGGCTACTGCTGGCGTTGGGGGCGGAGGTGGAGTGGGAGGGGGGCTTCTCCCGGCGCACGCGTACGCCGGGCACGGGTACGCCGCGGTGCCGACGTCGTTCCCCATCGCGTCGCACAGCTCGAGCGTGGTTGGCTCCGGTGGGCTGCAGTACTACGCTGGTACCGACTGCGGCGCGGCGGCGGCGGGTGCGGCGAAGACGACGACGACGGCGGCGGCGGCGGCGACGGCCGTGGCGGGGAGCGAGAGCGGCGTGCAGGTGCCCCGGTTCGCGACGCACCAGCACCATCTCCTGGCGGTGGTGAGCAGCGGGCGCGCGATGCTGGCGGCGCCCGACCAGCCGGGCGCCGGGCGCGACGACATGATCGACATGCTCAACTGGAGGCGAGGCTCCCACGGCCCCACCGCCTCCGCCGCCGCCACCACGCCCTCCCCGGCAAGCACCACCACCACGCTCACCACCTTCGCCAGCGCCGACGGCAGCAACAACGGCGAGGAGAACGAGGAGCTCGACCTCAACTTGAGCCTCTAG
Protein Sequence
- >LOC_Os03g57240.1
MDSPSPMAAQAADLSLTLAPSGGGGGGGGGGGGGGSSSACIDGKDVRLFPCLFCNKKFLKSQALGGHQNAHKKERSIGWNPYFYMPPTPHPAGNAAAAAAAATPGGMSSVTTPSGSYGVVGGAAVGATAGVGGGGGVGGGLLPAHAYAGHGYAAVPTSFPIASHSSSVVGSGGLQYYAGTDCGAAAAGAAKTTTTAAAAATAVAGSESGVQVPRFATHQHHLLAVVSSGRAMLAAPDQPGAGRDDMIDMLNWRRGSHGPTASAAATTPSPASTTTTLTTFASADGSNNGEENEELDLNLSL*