Gene Details:
- MSU gene ID: LOC_Os03g19590
- RAPdb gene ID: Os03g0309200
- Gene Symbol: PHYB OsphyB
- Genome: MSU7 , IRGSP-1.0
- Species: Oryza sativa
Functional Descriptions:
- To understand the underlying mechanism by which PHYB regulates drought tolerance, we analyzed root growth and water loss from the leaves of PHYB mutants.
- The root system showed no significant difference between the PHYB mutants and WT, suggesting that improved drought tolerance has little relation to root growth.
- Rice is a short-day plant, and we found that mutation in either PHYB or phyC caused moderate early flowering under the long-day photoperiod, while monogenic phyA mutation had little effect on the flowering time.
- The phyA mutation, however, in combination with PHYB or phyC mutation caused dramatic early flowering.
- A gene for 1-aminocyclopropane-1-carboxylate oxidase (ACO1), which is an ethylene biosynthesis gene contributing to internode elongation, was up-regulated in phyAPHYBphyC seedlings.
- In addition, the transcription levels of several ethylene- or gibberellin (GA)-related genes were changed in phyAPHYBphyC mutants, and measurement of the plant hormone levels indicated low ethylene production and bioactive GA levels in the phyAPHYBphyC mutants.
- We demonstrate that ethylene induced internode elongation and ACO1 expression in phyAPHYBphyC seedlings but not in the wild type and that the presence of bioactive GAs was necessary for these effects.
- Moreover, PHYB and phyA can affect Ghd7 activity and Early heading date1 (a floral inducer) activity in the network, respectively.
- In OsphyB mutants, OsCOL4 expression was decreased and OsphyB oscol4 double mutants flowered at the same time as the OsphyB single mutants, indicating OsCOL4 functions downstream of OsphyB.
- We also present evidence for two independent pathways through which OsphyB controls flowering time.
- OsCOL4 is a constitutive flowering repressor upstream of Ehd1 and downstream of OsphyB.
- Although phyAPHYBphyC phytochrome-null mutants in rice (Oryza sativa) have morphological changes and exhibit internode elongation, even as seedlings, it is unknown how phytochromes contribute to the control of internode elongation.
- ACO1 expression was controlled mainly by phyA and PHYB, and a histochemical analysis showed that ACO1 expression was localized to the basal parts of leaf sheaths of phyAPHYBphyC seedlings, similar to mature wild-type plants at the heading stage, when internode elongation was greatly promoted.
- The metabolite profiles indicated high accumulation of amino acids, organic acids, sugars, sugar phosphates, and nucleotides in the leaf blades of phyA PHYB phyC triple mutants, especially in the young leaves, compared with those in the WT.
- We report that phytochrome B (PHYB) mutants exhibit improved drought tolerance compared to wild type (WT) rice (Oryza sativa L.
- Considering all these findings, we propose that PHYB deficiency causes both reduced total leaf area and reduced transpiration per unit leaf area, which explains the reduced water loss and improved drought tolerance of PHYB mutants.
- We propose that both positive (OsMADS50 and Ehd1) and negative (Hd1, PHYB and Ghd7) regulators of RFT1 form a gene network that regulates LD flowering in rice.
- Seedlings of PHYB and PHYB phyC mutants exhibited a partial loss of sensitivity to continuous red light (Rc) but still showed significant deetiolation responses.
- Here, we report that phytochrome B (PHYB)-mediated suppression of Hd3a is a primary cause of long-day suppression of flowering in rice, based on the three complementary discoveries.
- First, overexpression of Hd1 causes a delay in flowering under SD conditions and this effect requires PHYB, suggesting that light modulates Hd1 control of Hd3a transcription.
- PHYB deficiency promoted the expression of both putative ERECTA family genes and EXPANSIN family genes involved in cell expansion in leaves, thus causing greater epidermal cell expansion in the PHYB mutants.
- In addition, the developed leaves of PHYB mutants displayed larger epidermal cells than WT leaves, resulting in reduced stomatal density.
- Reduced stomatal density resulted in reduced transpiration per unit leaf area in the PHYB mutants.
- However, PHYB mutants exhibited reduced total leaf area per plant, which was probably due to a reduction in the total number of cells per leaf caused by enhanced expression of Orysa;KRP1 and Orysa;KRP4 (encoding inhibitors of cyclin-dependent kinase complex activity) in the PHYB mutants.
- We examined the footprints of natural and artificial selections for four major genes of the photoperiod pathway, namely PHYTOCHROME B (PHYB), HEADING DATE 1 (Hd1), HEADING DATE 3a (Hd3a), and EARLY HEADING DATE 1 (Ehd1), by investigation of the patterns of nucleotide polymorphisms in cultivated and wild rice.
- Distinct metabolic profiles between phyA PHYB phyC triple mutants and the wild type (WT), as well as those between young and mature leaf blades, could be clearly observed by principal component analysis (PCA).
- These results suggest that PHYB mediates the regulation of chlorophyll synthesis through transcriptional regulation of these two genes, whose products exert their action at the branching point of the chlorophyll biosynthesis pathway.
- The RT-qPCR analysis revealed that several senescence-associated genes, including OsORE1 and OsEIN3, were significantly up-regulated in OsphyB-2 mutants, indicating that OsphyB also inhibits leaf senescence, like Arabidopsis PhyB.
- Unlike previous result, we found that OsphyB represses the activity of ascorbate peroxidase and catalase mediating reactive oxygen species (ROS) processing machinery required for drought tolerance of roots in soil condition, suggesting the potential significance of remaining uncharacterized candidate genes for manipulating drought tolerance in rice.
- OsPRR73 expression was decreased in OsphyB mutants, and overexpression of OsPRR73 complemented the early heading date phenotype of OsphyB, indicating OsPRR73 works downstream of OsphyB.
- Here, we found that PHYB mutation or shade treatment promoted rice resistance to ShB, while resistance was reduced by PHYB overexpression.
- Plants overexpressing PIL15 were more susceptible to ShB in contrast to bzr1-D-overexpressing plants compared with the wild-type, suggesting that PHYB may inhibit BZR1 to negatively regulate rice resistance to ShB.
- Further analysis showed that PHYB interacts with phytochrome-interacting factor-like 15 (PIL15), brassinazole resistant 1 (BZR1), and vascular plant one-zinc-finger 2 (VOZ2).
- The DL-reduced BPH resistance is relieved in OsphyB mutants, but aggravated in OsphyB overexpressing plants.
- In addition, we found that nuclear OsphyB stabilizes Ethylene Insensitive Like2 (OsEIL2) by competitively interacting with EIN3 Binding F-Box Protein (OsEBF1) to enhance ET signaling in rice, which contrasts with previous findings that phyB blocks ET signaling by facilitating Ethylene Insensitive3 (EIN3) degradation in other plant species.
Function-related keywords:
- growth , flower , ethylene , heading-date , ga , seedling , phosphate , flowering-time , floral , drought , sheath , drought-tolerance , gibberellin , root , leaf , erect , stomata , stomatal , branching , leaf-senescence , tolerance , reactive-oxygen-species , resistance , resistant
Literature:
- Phytochrome B regulates Heading date 1 (Hd1)-mediated expression of rice florigen Hd3a and critical day length in rice . DOI: 10.1007/s00438-011-0621-4 ; PMID: 21512732
- Phytochrome B control of total leaf area and stomatal density affects drought tolerance in rice . DOI: 10.1007/s11103-011-9860-3 ; PMID: 22138855
- Molecular dissection of the roles of phytochrome in photoperiodic flowering in rice . DOI: 10.1104/pp.111.181792 ; PMID: 21880933
- The multiple contributions of phytochromes to the control of internode elongation in rice . DOI: 10.1104/pp.111.184861 ; PMID: 21911595
- A gene network for long-day flowering activates RFT1 encoding a mobile flowering signal in rice . DOI: 10.1242/dev.040170 ; PMID: 19762423
- Cryptochrome and phytochrome cooperatively but independently reduce active gibberellin content in rice seedlings under light irradiation . DOI: 10.1093/pcp/pcs097 ; PMID: 22764280
- Rice JASMONATE RESISTANT 1 is involved in phytochrome and jasmonate signalling . DOI: 10.1111/j.1365-3040.2008.01790.x ; PMID: 18266905
- OsCOL4 is a constitutive flowering repressor upstream of Ehd1 and downstream of OsphyB . DOI: 10.1111/j.1365-313X.2010.04226.x ; PMID: 20409004
- Footprints of natural and artificial selection for photoperiod pathway genes in Oryza . DOI: 10.1111/j.1365-313X.2012.04915.x ; PMID: 22268451
- Phytochromes are the sole photoreceptors for perceiving red/far-red light in rice . DOI: 10.1073/pnas.0907378106 ; PMID: 19706555
- Distinct and cooperative functions of phytochromes A, B, and C in the control of deetiolation and flowering in rice . DOI: 10.1105/tpc.105.035899 ; PMID: 16278346
- Comprehensive metabolite profiling of phyA phyB phyC triple mutants to reveal their associated metabolic phenotype in rice leaves . DOI: 10.1016/j.jbiosc.2009.03.010 ; PMID: 19619864
- Phytochrome B Mediates the Regulation of Chlorophyll Biosynthesis through Transcriptional Regulation of ChlH and GUN4 in Rice Seedlings . DOI: 10.1371/journal.pone.0135408 ; PMID: 26270815
- Rice Phytochrome B (OsPhyB) Negatively Regulates Dark- and Starvation-Induced Leaf Senescence . DOI: 10.3390/plants4030644 ; PMID: 27135344
- OsPhyB-Mediating Novel Regulatory Pathway for Drought Tolerance in Rice Root Identified by a Global RNA-Seq Transcriptome Analysis of Rice Genes in Response to Water Deficiencies . DOI: 10.3389/fpls.2017.00580 ; PMID: 28491065
- Transcriptional and post-transcriptional regulation of heading date in rice . DOI: 10.1111/nph.17158 ; PMID: 33341945
- The transcriptional repressor OsPRR73 links circadian clock and photoperiod pathway to control heading date in rice . DOI: 10.1111/pce.13987 ; PMID: 33377200
- OsPRR37 Alternatively Promotes Heading Date Through Suppressing the Expression of Ghd7 in the Japonica Variety Zhonghua 11 under Natural Long-Day Conditions . DOI: 10.1186/s12284-021-00464-1 ; PMID: 33630174
- Red-light receptor phytochrome B inhibits BZR1-NAC028-CAD8B signaling to negatively regulate rice resistance to sheath blight . DOI: 10.1111/pce.14502 ; PMID: 36457051
- Phytochrome B mediates dim-light-reduced insect resistance by promoting the ethylene pathway in rice . DOI: 10.1093/plphys/kiac518 ; PMID: 36437699
- Mutation of phytochrome B promotes resistance to sheath blight and saline-alkaline stress via increasing ammonium uptake in rice . DOI: 10.1111/tpj.16046 ; PMID: 36440495
Related News:
Gene Resources:
- NCBI ID: AB109892
- UniProt accessions:
Sequences:
cDNA Sequence
- >LOC_Os03g19590.1
CATCGCATCGTCATCGCGACTCATCTCGCCTTAACGCAGCAGCAAGCCAACGCGACTGTGTGCAATCCCACTCTCATCTCCCTCAGTTACTGCCTTGCTCCCCAACCCCAGGAGCAAGCACAAGTCCACTGCGTGCGTGCGAGCGATGACTCCGATAACCGCAGGGGCGGTGAGGTGAGGTGAGGCGAGGAAAAAATCGGACGCACCCGCCTAATCCGGACCAATCCACCGCATCGGCGCCATGGCCTCGGGTAGCCGCGCCACGCCCACGCGCTCCCCCTCCTCCGCGCGGCCCGCGGCGCCGCGGCACCAGCACCACCACTCGCAGTCCTCGGGCGGGAGCACGTCCCGCGCGGGAGGGGGTGGCGGGGGCGGGGGAGGGGGAGGGGGCGGCGCGGCCGCCGCGGAGTCGGTGTCCAAGGCCGTGGCGCAGTACACCCTGGACGCGCGCCTCCACGCCGTGTTCGAGCAGTCGGGCGCGTCGGGCCGCAGCTTCGACTACACGCAGTCGCTGCGTGCGTCGCCCACCCCGTCCTCCGAGCAGCAGATCGCCGCCTACCTCTCCCGCATCCAGCGCGGCGGGCACATACAGCCCTTCGGCTGCACGCTCGCCGTCGCCGACGACTCCTCCTTCCGCCTCCTCGCCTACTCCGAGAACACCGCCGACCTGCTCGACCTGTCGCCCCACCACTCCGTCCCCTCGCTCGACTCCTCCGCGGTGCCTCCCCCCGTCTCGCTCGGCGCAGACGCGCGCCTCCTTTTCGCCCCCTCGTCCGCCGTCCTCCTCGAGCGCGCCTTCGCCGCGCGCGAGATCTCGCTGCTCAACCCGCTCTGGATCCACTCCAGGGTCTCCTCTAAACCCTTCTACGCCATCCTCCACCGCATCGATGTCGGCGTCGTCATCGACCTCGAGCCCGCCCGCACCGAGGATCCTGCACTCTCCATCGCTGGCGCAGTCCAGTCTCAGAAGCTCGCGGTCCGTGCCATCTCCCGCCTCCAGGCGCTTCCCGGCGGTGACGTCAAGCTCCTTTGCGACACCGTTGTTGAGTATGTTAGAGAGCTCACAGGTTATGACCGCGTTATGGTGTACAGGTTCCATGAGGATGAGCATGGAGAAGTCGTTGCCGAGAGCCGGCGCAATAACCTTGAGCCCTACATCGGGTTGCATTATCCTGCTACAGATATCCCACAGGCATCACGCTTCCTGTTCCGGCAGAACCGTGTGCGGATGATTGCTGATTGCCATGCTGCGCCGGTGAGGGTCATCCAGGATCCTGCACTAACACAGCCGCTGTGCTTGGTTGGGTCCACGCTGCGTTCGCCGCATGGTTGCCATGCGCAGTATATGGCGAACATGGGTTCCATTGCATCTCTTGTTATGGCAGTGATCATTAGTAGTGGTGGGGATGATGATCATAACATTTCACGGGGCAGCATCCCGTCGGCGATGAAGTTGTGGGGGTTGGTAGTATGCCACCACACATCTCCACGGTGCATCCCTTTCCCACTACGGTATGCATGCGAGTTCCTCATGCAAGCCTTTGGGTTGCAGCTCAACATGGAGTTGCAGCTTGCACACCAACTGTCAGAGAAACACATTCTGCGGACGCAGACACTGCTGTGTGATATGCTACTCCGGGATTCACCAACTGGCATTGTCACACAAAGCCCCAGCATCATGGACCTTGTGAAGTGTGATGGTGCTGCTCTGTATTACCATGGGAAGTACTACCCTCTTGGTGTCACTCCCACAGAAGTTCAGATTAAGGACATCATCGAGTGGTTGACTATGTGCCATGGAGACTCCACAGGGCTCAGCACAGATAGCCTTGCTGATGCAGGCTACCCTGGTGCTGCTGCACTAGGAGATGCAGTGAGTGGAATGGCGGTAGCATATATCACGCCAAGTGATTATTTGTTTTGGTTCCGGTCACACACAGCTAAGGAGATAAAGTGGGGTGGTGCAAAGCATCATCCAGAGGATAAGGATGATGGACAACGAATGCATCCACGATCATCGTTCAAGGCATTTCTTGAAGTTGTGAAGAGTAGGAGCTTACCATGGGAGAATGCGGAGATGGATGCAATACATTCCTTGCAGCTCATATTGCGGGACTCTTTCAGAGATTCTGCAGAGGGCACAAGTAACTCAAAAGCCATAGTGAATGGCCAGGTTCAGCTTGGGGAGCTAGAATTACGGGGAATAGATGAGCTTAGCTCGGTAGCAAGGGAGATGGTTCGGTTGATCGAGACAGCAACAGTACCCATCTTTGCAGTAGATACTGATGGATGTATAAATGGTTGGAATGCAAAGGTTGCTGAGCTGACAGGCCTCTCTGTTGAGGAAGCAATGGGCAAATCATTGGTAAATGATCTCATCTTCAAGGAATCTGAGGAAACAGTAAACAAGCTACTCTCACGAGCTTTAAGAGGTGATGAAGACAAAAATGTAGAGATAAAGTTGAAGACATTCGGGCCAGAACAATCTAAAGGACCAATATTCGTTATTGTGAATGCTTGTTCTAGCAGGGATTACACTAAAAATATTGTTGGTGTTTGTTTTGTTGGCCAAGATGTCACAGGACAAAAGGTGGTCATGGATAAATTTATCAACATACAAGGGGATTACAAGGCTATCGTACACAACCCTAATCCTCTCATACCCCCAATATTTGCTTCAGATGAGAATACTTGTTGTTCGGAGTGGAACACAGCAATGGAAAAACTCACAGGATGGTCAAGAGGGGAAGTTGTTGGTAAGCTTCTGGTCGGTGAGGTCTTTGGTAATTGTTGTCGACTCAAGGGCCCAGATGCATTAACGAAATTCATGATTGTCCTACACAACGCTATAGGAGGACAGGATTGTGAAAAGTTCCCCTTTTCATTTTTTGACAAGAATGGGAAATACGTGCAGGCCTTATTGACTGCAAACACGAGGAGCAGAATGGATGGTGAGGCCATAGGAGCCTTCTGTTTCTTGCAGATTGCAAGTCCTGAATTACAGCAAGCCTTTGAGATTCAGAGACACCATGAAAAGAAGTGTTATGCAAGGATGAAGGAATTGGCTTACATTTACCAGGAAATAAAGAATCCTCTCAACGGTATCCGATTTACAAACTCGTTATTGGAGATGACTGATCTAAAGGATGACCAGAGGCAGTTTCTTGAAACCAGCACTGCTTGTGAGAAACAGATGTCCAAAATTGTTAAGGATGCTAGCCTCCAAAGTATTGAGGATGGCTCTTTGGTGCTTGAGAAAGGTGAATTTTCACTAGGTAGTGTTATGAATGCTGTTGTCAGCCAAGTGATGATACAGTTGAGAGAAAGAGATTTACAACTTATTCGAGATATCCCTGATGAAATTAAAGAAGCCTCAGCATATGGTGACCAATATAGAATTCAACAAGTTTTATGTGACTTTTTGCTAAGCATGGTGAGGTTTGCTCCAGCTGAAAATGGCTGGGTGGAGATACAGGTCAGACCAAATATAAAACAAAATTCTGATGGAACAGACACAATGCTTTTCCTCTTCAGGTTTGCCTGTCCTGGCGAAGGCCTTCCCCCAGAGATTGTTCAAGACATGTTTAGTAACTCCCGCTGGACAACCCAAGAGGGTATTGGCCTAAGCATATGCAGGAAGATCCTAAAATTGATGGGTGGCGAGGTCCAATATATAAGGGAGTCGGAGCGGAGTTTCTTCCATATCGTACTTGAGCTGCCCCAGCCTCAGCAAGCAGCAAGTAGGGGGACAAGCTGATATGGTGTATGCTCGTCGCTAACCTCGCATAACTATTCGGTCAACCAGGTGACCTGGGATCTTCTGATGGAGAACCCAGTTTATGAGAGTTCCAGAAACCAACATTTCGTCCACTCTGATGAAGCACATCTGAACTTTGGAACGGCATCGGTGATTCTCGGTGTCGAGGTGGTCCCTCCAGTCTCCTGATTCCTGGCATGCCCGACTGTAAGTTCAGCTTTGGACGATGTTGTTCTATTAGAGTTCTATGGCGGCAAGCAATGCACACTGACGGTCATGTAACTCGTAGCATAGGCCCACTACCACTTGGTTGAAGTACATATATGTTCTAAAAGCTGCCATGTATATAACATCGGTTATATATGTACTACGTGCATAAGGAGAGCTGTGCAGCTCCCAGGGTGGTATTTTGTAGGGCTTCCCAAGCCTATGACATCTTATTATATCATCTTAACATAAAAGCATTTGGTTTCCTTGGATGTCGGCATCTACTCGATTCCCCAATTCTGTTGTGCAGAGTATTGTCCTG
CDS Sequence
- >LOC_Os03g19590.1
ATGGCCTCGGGTAGCCGCGCCACGCCCACGCGCTCCCCCTCCTCCGCGCGGCCCGCGGCGCCGCGGCACCAGCACCACCACTCGCAGTCCTCGGGCGGGAGCACGTCCCGCGCGGGAGGGGGTGGCGGGGGCGGGGGAGGGGGAGGGGGCGGCGCGGCCGCCGCGGAGTCGGTGTCCAAGGCCGTGGCGCAGTACACCCTGGACGCGCGCCTCCACGCCGTGTTCGAGCAGTCGGGCGCGTCGGGCCGCAGCTTCGACTACACGCAGTCGCTGCGTGCGTCGCCCACCCCGTCCTCCGAGCAGCAGATCGCCGCCTACCTCTCCCGCATCCAGCGCGGCGGGCACATACAGCCCTTCGGCTGCACGCTCGCCGTCGCCGACGACTCCTCCTTCCGCCTCCTCGCCTACTCCGAGAACACCGCCGACCTGCTCGACCTGTCGCCCCACCACTCCGTCCCCTCGCTCGACTCCTCCGCGGTGCCTCCCCCCGTCTCGCTCGGCGCAGACGCGCGCCTCCTTTTCGCCCCCTCGTCCGCCGTCCTCCTCGAGCGCGCCTTCGCCGCGCGCGAGATCTCGCTGCTCAACCCGCTCTGGATCCACTCCAGGGTCTCCTCTAAACCCTTCTACGCCATCCTCCACCGCATCGATGTCGGCGTCGTCATCGACCTCGAGCCCGCCCGCACCGAGGATCCTGCACTCTCCATCGCTGGCGCAGTCCAGTCTCAGAAGCTCGCGGTCCGTGCCATCTCCCGCCTCCAGGCGCTTCCCGGCGGTGACGTCAAGCTCCTTTGCGACACCGTTGTTGAGTATGTTAGAGAGCTCACAGGTTATGACCGCGTTATGGTGTACAGGTTCCATGAGGATGAGCATGGAGAAGTCGTTGCCGAGAGCCGGCGCAATAACCTTGAGCCCTACATCGGGTTGCATTATCCTGCTACAGATATCCCACAGGCATCACGCTTCCTGTTCCGGCAGAACCGTGTGCGGATGATTGCTGATTGCCATGCTGCGCCGGTGAGGGTCATCCAGGATCCTGCACTAACACAGCCGCTGTGCTTGGTTGGGTCCACGCTGCGTTCGCCGCATGGTTGCCATGCGCAGTATATGGCGAACATGGGTTCCATTGCATCTCTTGTTATGGCAGTGATCATTAGTAGTGGTGGGGATGATGATCATAACATTTCACGGGGCAGCATCCCGTCGGCGATGAAGTTGTGGGGGTTGGTAGTATGCCACCACACATCTCCACGGTGCATCCCTTTCCCACTACGGTATGCATGCGAGTTCCTCATGCAAGCCTTTGGGTTGCAGCTCAACATGGAGTTGCAGCTTGCACACCAACTGTCAGAGAAACACATTCTGCGGACGCAGACACTGCTGTGTGATATGCTACTCCGGGATTCACCAACTGGCATTGTCACACAAAGCCCCAGCATCATGGACCTTGTGAAGTGTGATGGTGCTGCTCTGTATTACCATGGGAAGTACTACCCTCTTGGTGTCACTCCCACAGAAGTTCAGATTAAGGACATCATCGAGTGGTTGACTATGTGCCATGGAGACTCCACAGGGCTCAGCACAGATAGCCTTGCTGATGCAGGCTACCCTGGTGCTGCTGCACTAGGAGATGCAGTGAGTGGAATGGCGGTAGCATATATCACGCCAAGTGATTATTTGTTTTGGTTCCGGTCACACACAGCTAAGGAGATAAAGTGGGGTGGTGCAAAGCATCATCCAGAGGATAAGGATGATGGACAACGAATGCATCCACGATCATCGTTCAAGGCATTTCTTGAAGTTGTGAAGAGTAGGAGCTTACCATGGGAGAATGCGGAGATGGATGCAATACATTCCTTGCAGCTCATATTGCGGGACTCTTTCAGAGATTCTGCAGAGGGCACAAGTAACTCAAAAGCCATAGTGAATGGCCAGGTTCAGCTTGGGGAGCTAGAATTACGGGGAATAGATGAGCTTAGCTCGGTAGCAAGGGAGATGGTTCGGTTGATCGAGACAGCAACAGTACCCATCTTTGCAGTAGATACTGATGGATGTATAAATGGTTGGAATGCAAAGGTTGCTGAGCTGACAGGCCTCTCTGTTGAGGAAGCAATGGGCAAATCATTGGTAAATGATCTCATCTTCAAGGAATCTGAGGAAACAGTAAACAAGCTACTCTCACGAGCTTTAAGAGGTGATGAAGACAAAAATGTAGAGATAAAGTTGAAGACATTCGGGCCAGAACAATCTAAAGGACCAATATTCGTTATTGTGAATGCTTGTTCTAGCAGGGATTACACTAAAAATATTGTTGGTGTTTGTTTTGTTGGCCAAGATGTCACAGGACAAAAGGTGGTCATGGATAAATTTATCAACATACAAGGGGATTACAAGGCTATCGTACACAACCCTAATCCTCTCATACCCCCAATATTTGCTTCAGATGAGAATACTTGTTGTTCGGAGTGGAACACAGCAATGGAAAAACTCACAGGATGGTCAAGAGGGGAAGTTGTTGGTAAGCTTCTGGTCGGTGAGGTCTTTGGTAATTGTTGTCGACTCAAGGGCCCAGATGCATTAACGAAATTCATGATTGTCCTACACAACGCTATAGGAGGACAGGATTGTGAAAAGTTCCCCTTTTCATTTTTTGACAAGAATGGGAAATACGTGCAGGCCTTATTGACTGCAAACACGAGGAGCAGAATGGATGGTGAGGCCATAGGAGCCTTCTGTTTCTTGCAGATTGCAAGTCCTGAATTACAGCAAGCCTTTGAGATTCAGAGACACCATGAAAAGAAGTGTTATGCAAGGATGAAGGAATTGGCTTACATTTACCAGGAAATAAAGAATCCTCTCAACGGTATCCGATTTACAAACTCGTTATTGGAGATGACTGATCTAAAGGATGACCAGAGGCAGTTTCTTGAAACCAGCACTGCTTGTGAGAAACAGATGTCCAAAATTGTTAAGGATGCTAGCCTCCAAAGTATTGAGGATGGCTCTTTGGTGCTTGAGAAAGGTGAATTTTCACTAGGTAGTGTTATGAATGCTGTTGTCAGCCAAGTGATGATACAGTTGAGAGAAAGAGATTTACAACTTATTCGAGATATCCCTGATGAAATTAAAGAAGCCTCAGCATATGGTGACCAATATAGAATTCAACAAGTTTTATGTGACTTTTTGCTAAGCATGGTGAGGTTTGCTCCAGCTGAAAATGGCTGGGTGGAGATACAGGTCAGACCAAATATAAAACAAAATTCTGATGGAACAGACACAATGCTTTTCCTCTTCAGGTTTGCCTGTCCTGGCGAAGGCCTTCCCCCAGAGATTGTTCAAGACATGTTTAGTAACTCCCGCTGGACAACCCAAGAGGGTATTGGCCTAAGCATATGCAGGAAGATCCTAAAATTGATGGGTGGCGAGGTCCAATATATAAGGGAGTCGGAGCGGAGTTTCTTCCATATCGTACTTGAGCTGCCCCAGCCTCAGCAAGCAGCAAGTAGGGGGACAAGCTGA
Protein Sequence
- >LOC_Os03g19590.1
MASGSRATPTRSPSSARPAAPRHQHHHSQSSGGSTSRAGGGGGGGGGGGGGAAAAESVSKAVAQYTLDARLHAVFEQSGASGRSFDYTQSLRASPTPSSEQQIAAYLSRIQRGGHIQPFGCTLAVADDSSFRLLAYSENTADLLDLSPHHSVPSLDSSAVPPPVSLGADARLLFAPSSAVLLERAFAAREISLLNPLWIHSRVSSKPFYAILHRIDVGVVIDLEPARTEDPALSIAGAVQSQKLAVRAISRLQALPGGDVKLLCDTVVEYVRELTGYDRVMVYRFHEDEHGEVVAESRRNNLEPYIGLHYPATDIPQASRFLFRQNRVRMIADCHAAPVRVIQDPALTQPLCLVGSTLRSPHGCHAQYMANMGSIASLVMAVIISSGGDDDHNISRGSIPSAMKLWGLVVCHHTSPRCIPFPLRYACEFLMQAFGLQLNMELQLAHQLSEKHILRTQTLLCDMLLRDSPTGIVTQSPSIMDLVKCDGAALYYHGKYYPLGVTPTEVQIKDIIEWLTMCHGDSTGLSTDSLADAGYPGAAALGDAVSGMAVAYITPSDYLFWFRSHTAKEIKWGGAKHHPEDKDDGQRMHPRSSFKAFLEVVKSRSLPWENAEMDAIHSLQLILRDSFRDSAEGTSNSKAIVNGQVQLGELELRGIDELSSVAREMVRLIETATVPIFAVDTDGCINGWNAKVAELTGLSVEEAMGKSLVNDLIFKESEETVNKLLSRALRGDEDKNVEIKLKTFGPEQSKGPIFVIVNACSSRDYTKNIVGVCFVGQDVTGQKVVMDKFINIQGDYKAIVHNPNPLIPPIFASDENTCCSEWNTAMEKLTGWSRGEVVGKLLVGEVFGNCCRLKGPDALTKFMIVLHNAIGGQDCEKFPFSFFDKNGKYVQALLTANTRSRMDGEAIGAFCFLQIASPELQQAFEIQRHHEKKCYARMKELAYIYQEIKNPLNGIRFTNSLLEMTDLKDDQRQFLETSTACEKQMSKIVKDASLQSIEDGSLVLEKGEFSLGSVMNAVVSQVMIQLRERDLQLIRDIPDEIKEASAYGDQYRIQQVLCDFLLSMVRFAPAENGWVEIQVRPNIKQNSDGTDTMLFLFRFACPGEGLPPEIVQDMFSNSRWTTQEGIGLSICRKILKLMGGEVQYIRESERSFFHIVLELPQPQQAASRGTS*