OsJAZ9;OsTIFY11a

Gene Details

MSU gene ID: LOC_Os03g08310
RAPdb gene ID: Os03g0180800
Gene Symbol: OsJAZ9 OsTIFY11a
Genome: MSU7 , IRGSP-1.0
Species: Oryza sativa

Functional Descriptions

Over-expression of OsTIFY11a, one of the stress-inducible genes, resulted in significantly increased tolerance to salt and dehydration stresses.
OsJAZ9 interacts with several bHLH transcription factors including OsbHLH062 via the Jas domain.
OsJAZ9 acts as a transcriptional regulator in jasmonate signaling and modulates salt stress tolerance in rice.
Suppression of OsJAZ9 resulted in reduced salt tolerance.
These results together suggest that OsJAZ9 acts as a transcriptional regulator by forming a transcriptional regulation complex with OsNINJA and OsbHLH to fine tune the expression of JA-responsive genes involved in salt stress tolerance in rice.
OsJAZ9 interacts with OsCOI1a, a component of the SCF(COI1) E3 ubiquitin ligase complex, in a coronatine-dependent manner, suggesting that OsJAZ9 is involved in the regulation of JA signaling.
We found that OsJAZ9 can also interact with OsNINJA, a rice homolog of the Arabidopsis thaliana transcriptional repressor NINJA in JA signaling.
Based on this broader interaction, we explored the function of OsJAZ9 in JA and GA responses by analyzing transcript levels of the JA-responsive gene OsbHLH148 and the GA-responsive gene OsPIL14 in OsJAZ9-overexpressing (OsJAZ9-Ox) and OsJAZ9 mutant plants.
These observations indicated that OsJAZ9 regulates both JA and GA responses in rice, and this finding was supported by the opposite expression patterns of OsDREB1s, downstream targets of OsbHLH148 and OsPIL14, in the OsJAZ9-Ox and OsJAZ9 plants.
Together, these findings indicate that OsJAZ9 suppresses JA responses and promotes GA responses in rice, and the protein-protein interaction between OsJAZ9 and SLR1 is involved in the antagonistic interplay between JA and GA.
Transcriptome analysis of rice (Oryza sativa L.) in response to ammonium resupply reveals the involvement of phytohormone signaling and the transcription factor OsJAZ9 in reprogramming of nitrogen uptake and metabolism.
The transcription factor OsJAZ9 was the most pronouncedly induced component under low NH4+ in roots, and a significant increase in root growth, NH4+ absorption, amino acid, and sugar metabolism in response to resupplied NH4+ following nitrogen starvation was identified in JAZ9ox (OsJAZ9-overexpressed) and coi1 (OsCOI1-RNAi).
Our data provide comprehensive insight into the whole-plant transcriptomic response in terms of metabolic processes and signaling transduction to a low-NH4+ signal, and identify the transcription factor OsJAZ9 and its involvement in the regulation of carbon/nitrogen metabolism as central to the response to low NH4+.
Furthermore, we established that OsJAZ9 overexpression and knockdown result in K deficiency tolerance and sensitivity, respectively, by modulating various K transporters and root system architecture.
Enhanced bioactive JA (JA-Ile) accumulation in OsJAZ9 overexpressing rice helps plants tolerate K deficiency.
Here, we integrated molecular, physiological and morphological studies to analyze the role of OsJAZ9 in JA homeostasis and K deficiency responses.
We raised OsJAZ9 over-expression, knockdown, transcriptional reporter, translational reporter and C-terminal deleted translational reporter lines in rice to establish the role of JA signaling in K ion homeostasis.
JA profiling revealed significantly increased JA-Ile levels in OsJAZ9 OE lines under K deficiency.
Our data provide evidence on the crucial roles of OsJAZ9 for improving K deficiency tolerance in rice by altering JA levels and JA responses.
OsJAZ9 overexpression modulates jasmonic acid biosynthesis and potassium deficiency responses in rice.
OsJAZ9 is involved in water-deficit stress tolerance by regulating leaf width and stomatal density in rice.
Further, OsJAZ9 overexpression reduces leaf width and stomata density, leading to lower leaf transpiration rates than WT.
Here we report that OsJAZ9 plays a critical role in rice water-deficit stress tolerance via influencing JA and ABA signalling.
Overexpression of OsJAZ9 led to the enhanced ABA and JA levels.
This reduced transpiration and higher K content as osmoticum improved the water-deficit stress tolerance in OsJAZ9 overexpression lines.
Our previous report demonstrated the role of OsJAZ9 in potassium homeostasis by modulating Jasmonic Acid (JA) signalling.
On the contrary, OsJAZ9 RNAi lines displayed enhanced sensitivity towards water-deficit stress.

Functional Keywords

Literature and News

Gene Resources

Sequences

cDNA Sequence

>LOC_Os03g08310.1
AACCATATGTGATCAGCGACGTACAGTACAGATCGTTCGCAATAAAGTTAGACTTCTCGTCTCTCTTTGTGCTTGTGCTTAGTTGTCCGTGCTAGAAGACGGCAATGGCGTCGACGGATCCCATGACCCGCCGCTTCGCCGTCGCGTGCGGCGTGCTCAGCCAGTACGTCAAGGCCAACTCCTCGCAGCCGTCGACGGCGGCGCCGGTGGCTCAAGGTGTGAGTGGCCTCATGGCCGCCGCCGCCGCCGCCGCCGCGGCGCCTGTGGTCCAGGAACCCGGATGCGAGGTGGACGGCGGGGGGCAGCAGTTCACGATCTTCTACGCCGGGAAGGTGGTGGTGATCGACCGCTGCACGCCGGCCATGGCGGCCGAGCTGATGCGGTTCGCGTCGGCGGCGCAGGGCGGCGGCGGCGCGCCAGAGGCGCCGCCCGCGCTGGTGGACATGCCGATCGCGAGGAAGGCGTCGCTGAAGCGGTTCCTGGCGAAGCGCAAGGCCACCCCCGCCTCCGCGCGGTCGTCGTACGTCGTCCGTGCTGCGGCGGCGGAGGAGGAGCAGCCGCCGGCGAAGAAAGCGAAGGCGGCCGTGGAGAGGCGCGAGGATTGGCTCGCGCTGGGAAGCCTTGGACACATGCACTCGCGCTGATGATCATCGCCACGACGTCACGTCTGCGATTTGAGAATTGAGAGCTCGATCGATTGATCGCCATGTGGTCACCCGGTAGCCGATGCTGCAAGGCCGGTCGAGTTGGAAGATGGTTCTCGTCGCATTAACGGCCTTGAGTTGATTTCGCCGAGCCTGACCTTGAGTTGATTACCATGGAAGTATGAAGATTTCGTGATTAGCAGTTACCCTAGTTATCGCGGCGTATAATTAAGCACGGTCACTGAAGCGCAATGGCCTTGAGTCGGTAGATCAGGACTAGAGAGGGGTGTATGGATCTGACAAGTACTGTAGTATATTGTATCCCGTTTGAATTTTTTTTCGATTCCTATGGGGACTGAATTGATTAATGATATAAAATTCCTTCGACTGTTCTGAAA

CDS Sequence

>LOC_Os03g08310.1
ATGGCGTCGACGGATCCCATGACCCGCCGCTTCGCCGTCGCGTGCGGCGTGCTCAGCCAGTACGTCAAGGCCAACTCCTCGCAGCCGTCGACGGCGGCGCCGGTGGCTCAAGGTGTGAGTGGCCTCATGGCCGCCGCCGCCGCCGCCGCCGCGGCGCCTGTGGTCCAGGAACCCGGATGCGAGGTGGACGGCGGGGGGCAGCAGTTCACGATCTTCTACGCCGGGAAGGTGGTGGTGATCGACCGCTGCACGCCGGCCATGGCGGCCGAGCTGATGCGGTTCGCGTCGGCGGCGCAGGGCGGCGGCGGCGCGCCAGAGGCGCCGCCCGCGCTGGTGGACATGCCGATCGCGAGGAAGGCGTCGCTGAAGCGGTTCCTGGCGAAGCGCAAGGCCACCCCCGCCTCCGCGCGGTCGTCGTACGTCGTCCGTGCTGCGGCGGCGGAGGAGGAGCAGCCGCCGGCGAAGAAAGCGAAGGCGGCCGTGGAGAGGCGCGAGGATTGGCTCGCGCTGGGAAGCCTTGGACACATGCACTCGCGCTGA

Protein Sequence

>LOC_Os03g08310.1
MASTDPMTRRFAVACGVLSQYVKANSSQPSTAAPVAQGVSGLMAAAAAAAAAPVVQEPGCEVDGGGQQFTIFYAGKVVVIDRCTPAMAAELMRFASAAQGGGGAPEAPPALVDMPIARKASLKRFLAKRKATPASARSSYVVRAAAAEEEQPPAKKAKAAVERREDWLALGSLGHMHSR*