Information report for OsPht1;2;OsPT2
Gene Details
|
|
Functional Descriptions
- OsSPX1 suppresses the function of OsPHR2 in the regulation of expression of OsPT2 and phosphate homeostasis in shoots of rice.
-
- OsPT2, the most abundantly expressed Pi transporter in the roots, is also significantly up-regulated in ltn1 and dramatically induced by Pi starvation.
-
- These data strongly demonstrate that selenite and Pi share similar uptake mechanisms and that OsPT2 is involved in selenite uptake, which provides a potential strategy for breeding Se-enriched rice varieties.
- Taken together, these data suggest OsPT6 plays a broad role in Pi uptake and translocation throughout the plant, whereas OsPT2 is a low-affinity Pi transporter, and functions in translocation of the stored Pi in the plant.
- OsPT2 is responsible for most of the OsPHR2-mediated accumulation of excess Pi in shoots.
- OsPT2, a phosphate transporter, is involved in the active uptake of selenite in rice.
- Expression of OsPT2 (phosphate transporter 2) and OsPT8 was significantly induced in OsSPX1-RNAi (OsSPX1-Ri) plants, suggesting that over-accumulation of Pi in OsSPX1-Ri plants results from an increase in Pi transport.
- In contrast, overexpression of OsSPX1 suppressed the induction of expression by Pi starvation of all 10 phosphate starvation-induced genes tested: IPS1 (induced by phosphate starvation 1), IPS2, OsPAP10 (purple acid phosphatase 10), OsSQD2 (sulfoquinovosyldiacylglycerol 2), miR399d and miR399j (microRNA 399), OsPT2, OsPT3, OsPT6 and OsPT8.
- In transgenic rice, the knock-down of either OsPT2 or OsPT6 expression by RNA interference significantly decreased both the uptake and the long-distance transport of Pi from roots to shoots.
- Two rice phosphate transporters, OsPht1;2 and OsPht1;6, have different functions and kinetic properties in uptake and translocation.
- Se content in rice grains also increased significantly in OsPT2-overexpressing plants.
- OsPHR2 positively regulates the low-affinity Pi transporter OsPT2 through physical interaction and reciprocal regulation of OsPHO2 in roots.
- OsPT6, but not OsPT2, was able to complement a yeast Pi uptake mutant in the high-affinity concentration range.
- Xenopus oocytes injected with OsPT2 mRNA showed increased Pi accumulation and a Pi-elicited depolarization of the cell membrane electrical potential, when supplied with mM external concentrations.
- Both results show that OsPT2 mediated the uptake of Pi in oocytes.
- Moreover, expression of OsPT2, which encodes a low-affinity Pi transporter, was up-regulated in OsMYB2P-1-overexpressing plants under Pi-sufficient conditions, whereas expression of the high-affinity Pi transporters OsPT6, OsPT8, and OsPT10 was up-regulated by overexpression of OsMYB2P-1 under Pi-deficient conditions, suggesting that OsMYB2P-1 may act as a Pi-dependent regulator in controlling the expression of Pi transporters.
- Here we report that OsPHR2 positively regulates the low-affinity Pi transporter gene OsPT2 by physical interaction and upstream regulation of OsPHO2 in roots.
- OsSPX1 suppresses the regulation on expression of OsPT2 by OsPHR2 and the accumulation of excess shoot Pi, but it does not suppress induction of OsPT2 or the accumulation of excessive shoot Pi in the Ospho2 mutant.
- The data indicate that mutation of OsPHF1 results in the endoplasmic reticulum retention of the low-affinity Pi transporter OsPT2 and high-affinity Pi transporter OsPT8.
- By using transgenic rice plants expressing the GUS reporter gene, driven by their promoters, we detected that OsPT2 was localized exclusively in the stele of primary and lateral roots, whereas OsPT6 was expressed in both epidermal and cortical cells of the younger primary and lateral roots.
- OsPT2 is responsible for most of the OsPHR2-mediated accumulation of excess shoot Pi.
- Differential effects of nitrogen forms on cell wall phosphorus remobilization in rice (Oryza sativa) are mediated by nitric oxide, pectin content and the expression of the phosphate transporter OsPT2.
- What’s more, the phosphate transporter gene OsPT2 is upregulated under NH4+ supplementation and is therefore involved in the stimulated P remobilization.
- Constitutive over-expression of OsPT2 may have negative effects on the growth of rice seedlings under high Pi condition.
- Under Pi-sufficient condition, there were a series of symptoms of phosphorus toxicity in the shoots of OsPT2 over-expressing (Ov-OsPT2) seedlings.
- Over-expression of OsPT2 under a rice root specific promoter Os03g01700.
- Rice plants overexpressing OsPP95 reduced OsPT8 phosphorylation and promoted OsPT2 and OsPT8 trafficking from the ER to the PM, resulting in Pi accumulation.
- We demonstrate that the protein phosphatase type 2C (PP2C) protein phosphatase OsPP95 interacts with OsPT2 and OsPT8 and dephosphorylates OsPT8 at Ser-517.
- High Zn supply triggered P starvation signal in root, thereafter increased the activities of both root-endogenous and -secreted acid phosphatase to release more Pi, and induced the expression OsPT2 and OsPT8 to uptake more P for plant growth.
- Our results showed that high level of Zn decreased the rice biomass and yield production, and inhibited the root-to-shoot translocation and distribution of P into new leaves by down-regulating P transporter genes OsPT2 and OsPT8 in shoot, which was controlled by OsPHR2-OsmiR399-OsPHO2 module.
- The transcription factor OsWRKY10 inhibits phosphate uptake via suppressing OsPht1;2 expression under phosphate-replete condition in rice.
- Genetic analysis showed that OsPht1;2 was responsible for the increased Pi accumulation in oswrky10.
Functional Keywords
- homeostasis , pi , transporter , shoot , phosphate , grain , breeding , root , lateral-root , nitrogen , cell-wall , phosphorus , phosphate-transport , seedlings , growth , Pi , phosphatase , protein-phosphatase , yield , plant-growth , biomass , transcription-factor
Literature and News
- Molecular mechanisms regulating Pi-signaling and Pi homeostasis under OsPHR2, a central Pi-signaling regulator, in rice . DOI: 10.1007/s11515-011-1050-9
- OsMYB2P-1, an R2R3 MYB transcription factor, is involved in the regulation of phosphate-starvation responses and root architecture in rice . DOI: 10.1104/pp.112.194217 ; PMID: 22395576
- OsSPX1 suppresses the function of OsPHR2 in the regulation of expression of OsPT2 and phosphate homeostasis in shoots of rice . DOI: 10.1111/j.1365-313X.2010.04170.x ; PMID: 20149131
- OsPHF1 regulates the plasma membrane localization of low- and high-affinity inorganic phosphate transporters and determines inorganic phosphate uptake and translocation in rice . DOI: 10.1104/pp.111.181669 ; PMID: 21753117
- Two rice phosphate transporters, OsPht1;2 and OsPht1;6, have different functions and kinetic properties in uptake and translocation . DOI: 10.1111/j.1365-313X.2008.03726.x ; PMID: 18980647
- Involvement of OsSPX1 in phosphate homeostasis in rice . DOI: 10.1111/j.1365-313X.2008.03734.x ; PMID: 19000161
- OsPT2, a phosphate transporter, is involved in the active uptake of selenite in rice . DOI: 10.1111/nph.12596 ; PMID: 24491113
- Rice phosphate transporters include an evolutionarily divergent gene specifically activated in arbuscular mycorrhizal symbiosis . DOI: 10.1073/pnas.202474599 ; PMID: 12271140
- Differential Effects of Nitrogen Forms on Cell Wall Phosphorus Remobilization Are Mediated by Nitric Oxide, Pectin Content, and Phosphate Transporter Expression . DOI: 10.1104/pp.16.00176 ; PMID: 27208223
- Over-expression of OsPT2 under a rice root specific promoter Os03g01700 . DOI: 10.1016/j.plaphy.2019.01.009 ; PMID: 30641408
- High level of zinc triggers phosphorus starvation by inhibiting root-to-shoot translocation and preferential distribution of phosphorus in rice plants . DOI: 10.1016/j.envpol.2021.116778 ; PMID: 33639599
- Trait variations and expression profiling of OsPHT1 gene family at the early growth-stages under phosphorus-limited conditions . DOI: 10.1038/s41598-021-92580-7 ; PMID: 34193908
- Putrescine is involved in root cell wall phosphorus remobilization in a nitric oxide dependent manner . DOI: 10.1016/j.plantsci.2021.111169 ; PMID: 35151453
- The transcription factor OsWRKY10 inhibits phosphate uptake via suppressing OsPHT1;2 expression under phosphate-replete conditions in rice . DOI: 10.1093/jxb/erac456 ; PMID: 36402551
- Ammonium improved cell wall and cell membrane P reutilization and external P uptake in a putrescine and ethylene dependent pathway . DOI: 10.1016/j.plaphy.2022.09.018 ; PMID: 36195034
Gene Resources
- UniProt: Q8GSD9
- EMBL: AF536959, AF536962, AP008209
- AlphaFoldDB: Q8GSD9
- EnsemblPlants: Os03t0150800-01
- Gramene: Os03t0150800-01
- KEGG: dosa:Os03g0150800
- Orthologous matrix: ESFPTRY
- InterPro: IPR004738, IPR005828, IPR020846
Sequences
cDNA Sequence
- >LOC_Os03g05640.1
CTAAGCAAAGCTTATAACTTTGCAGCTTGAGGAAAAAAGATCATCATGGCGGGATCGCAGCTCAACGTTTTGGTCAAGCTCGACCAGGCCAAGACGCAATGGTACCATTTCATGGCGATCGTCATCGCCGGGATGGGGTTCTTCACAGACGCCTACGACCTCTTTTGCATCGCGCTGGTCACCAAGCTGTTGGGTCGCCTTTACTACACCGACATCACCAAGCCCAACCCAGGGACACTCCCGCCCAACGTGTCGTCCGCCGTCACCGGCGTCGCGCTCTGCGGCACGCTCGCCGGCCAGCTCTTCTTCGGATGGCTCGGCGACAAGCTCGGCCGCAAGAGCGTCTATGGATTCACGCTCATCCTCATGGTCGTGTGCTCCATCGCCTCCGGTCTCTCGTTTGGCCACACGCCCAAGAGCGTGATTGCCACGCTCTGCTTCTTCCGCTTCTGGCTCGGCTTCGGCATCGGCGGCGACTACCCGCTCAGCGCCACCATCATGTCGGAGTACGCGAGCAAGAAGACCCGCGGGGCCTTCATCGCCGCCGTGTTCGCCATGCAGGGGTTCGGGATCCTCTTCGGCGCCATCGTCGCGCTCGTCGTCTCGGCCGGCTTCCGTCACGCGTACCCGGCGCCGTCGTACGCCCAGAACCCCGCCGCGTCGCTCGCGCCGCAGGCTGACTACACGTGGCGGCTCATCCTCATGTTCGGCACCATCCCGGCTGGGCTCACCTACTACTGGCGCATGAAAATGCCCGAGACGGCGCGGTACACGGCGCTCGTCGCCCGCAACGCCAAGCAGGCGGCGGCTGACATGTCCAAGGTGCTCCACGCCGAGATCGAGGAGCGGCCGGAGGTGGTCGAGAGCCAGGTGGTCGCCGGGGAGACCTGGGGCCTCTTCTCACGGCAGTTCATGAAGCGCCACGGGATGCACCTCCTGGCGACCACCAGCACGTGGTTCCTGCTCGACATCGCCTTCTACAGCCAGAACCTGTTCCAGAAGGACATCTTCAGCAAGGTCGGGTGGATACCGCCGGCGAAGACCATGAACGCGCTCGAGGAACTCTACCGCATCTCCCGCGCCCAGGCACTCATCGCACTCTGCGGAACCATCCCGGGCTACTGGTTCACCGTCGCCTTCATCGACATCGTCGGCAGGTTCTGGATCCAGATCATGGGCTTCTTCATGATGACCGTGTTCATGCTCGCGCTCGGCGTGCCCTACGACCACTGGACGCACCCGGCGCACCACACCGGCTTCGTCGTGCTCTACGCACTCACCTTCTTCTTCGCCAACTTCGGGCCCAACAGCACCACCTTCATCGTGCCGGCTGAGATCTTCCCGGCGAGGCTCCGGTCGACGTGCCACGGCATCTCCGCCGCGTCCGGCAAGGCCGGCGCGATCATCGGCGCGTTCGGGTTCCTGTACGCTGCGCAGGACCAGCACAATCCCGACGCGGGATACTCCCGCGGCATCGGCATCCGGAACGCGCTCTTCGTGCTCGCCGGCACAAACTTCCTCGGTATGCTCATGACGCTGCTGGTGCCGGAGTCCAAGGGCTTGTCGCTGGAGGAGATGTCCAAGGACAACGTCGTCGACGAGACCGCCCAAGAAGCGATCGCCCAAGCGTGATGTCATAAACATGCCGTCTCGACGTGAGTGACTGAAAAAAAATGTATGCTTTATTACTCTATTGGTGTGATTACTTAATCTAGTTTTGTATACTTTTGTAGTGTCTCTCCTTTTACAGTTGTGGATTTGTGGGGTTTCTCTTTCTTTCTTTTTTTTTGGTTGAAACAATTAAACTTGTTTGTGAGATTTTGTGAACTTTCCCTGCAACTGATATAAATGGCATACATTCATTTCAATTGTATTGTAAATGGCGTGAGCGGCTTTGCAAACCGCTAATAATATTGTTACACTTTCGTTA
CDS Sequence
- >LOC_Os03g05640.1
ATGGCGGGATCGCAGCTCAACGTTTTGGTCAAGCTCGACCAGGCCAAGACGCAATGGTACCATTTCATGGCGATCGTCATCGCCGGGATGGGGTTCTTCACAGACGCCTACGACCTCTTTTGCATCGCGCTGGTCACCAAGCTGTTGGGTCGCCTTTACTACACCGACATCACCAAGCCCAACCCAGGGACACTCCCGCCCAACGTGTCGTCCGCCGTCACCGGCGTCGCGCTCTGCGGCACGCTCGCCGGCCAGCTCTTCTTCGGATGGCTCGGCGACAAGCTCGGCCGCAAGAGCGTCTATGGATTCACGCTCATCCTCATGGTCGTGTGCTCCATCGCCTCCGGTCTCTCGTTTGGCCACACGCCCAAGAGCGTGATTGCCACGCTCTGCTTCTTCCGCTTCTGGCTCGGCTTCGGCATCGGCGGCGACTACCCGCTCAGCGCCACCATCATGTCGGAGTACGCGAGCAAGAAGACCCGCGGGGCCTTCATCGCCGCCGTGTTCGCCATGCAGGGGTTCGGGATCCTCTTCGGCGCCATCGTCGCGCTCGTCGTCTCGGCCGGCTTCCGTCACGCGTACCCGGCGCCGTCGTACGCCCAGAACCCCGCCGCGTCGCTCGCGCCGCAGGCTGACTACACGTGGCGGCTCATCCTCATGTTCGGCACCATCCCGGCTGGGCTCACCTACTACTGGCGCATGAAAATGCCCGAGACGGCGCGGTACACGGCGCTCGTCGCCCGCAACGCCAAGCAGGCGGCGGCTGACATGTCCAAGGTGCTCCACGCCGAGATCGAGGAGCGGCCGGAGGTGGTCGAGAGCCAGGTGGTCGCCGGGGAGACCTGGGGCCTCTTCTCACGGCAGTTCATGAAGCGCCACGGGATGCACCTCCTGGCGACCACCAGCACGTGGTTCCTGCTCGACATCGCCTTCTACAGCCAGAACCTGTTCCAGAAGGACATCTTCAGCAAGGTCGGGTGGATACCGCCGGCGAAGACCATGAACGCGCTCGAGGAACTCTACCGCATCTCCCGCGCCCAGGCACTCATCGCACTCTGCGGAACCATCCCGGGCTACTGGTTCACCGTCGCCTTCATCGACATCGTCGGCAGGTTCTGGATCCAGATCATGGGCTTCTTCATGATGACCGTGTTCATGCTCGCGCTCGGCGTGCCCTACGACCACTGGACGCACCCGGCGCACCACACCGGCTTCGTCGTGCTCTACGCACTCACCTTCTTCTTCGCCAACTTCGGGCCCAACAGCACCACCTTCATCGTGCCGGCTGAGATCTTCCCGGCGAGGCTCCGGTCGACGTGCCACGGCATCTCCGCCGCGTCCGGCAAGGCCGGCGCGATCATCGGCGCGTTCGGGTTCCTGTACGCTGCGCAGGACCAGCACAATCCCGACGCGGGATACTCCCGCGGCATCGGCATCCGGAACGCGCTCTTCGTGCTCGCCGGCACAAACTTCCTCGGTATGCTCATGACGCTGCTGGTGCCGGAGTCCAAGGGCTTGTCGCTGGAGGAGATGTCCAAGGACAACGTCGTCGACGAGACCGCCCAAGAAGCGATCGCCCAAGCGTGA
Protein Sequence
- >LOC_Os03g05640.1
MAGSQLNVLVKLDQAKTQWYHFMAIVIAGMGFFTDAYDLFCIALVTKLLGRLYYTDITKPNPGTLPPNVSSAVTGVALCGTLAGQLFFGWLGDKLGRKSVYGFTLILMVVCSIASGLSFGHTPKSVIATLCFFRFWLGFGIGGDYPLSATIMSEYASKKTRGAFIAAVFAMQGFGILFGAIVALVVSAGFRHAYPAPSYAQNPAASLAPQADYTWRLILMFGTIPAGLTYYWRMKMPETARYTALVARNAKQAAADMSKVLHAEIEERPEVVESQVVAGETWGLFSRQFMKRHGMHLLATTSTWFLLDIAFYSQNLFQKDIFSKVGWIPPAKTMNALEELYRISRAQALIALCGTIPGYWFTVAFIDIVGRFWIQIMGFFMMTVFMLALGVPYDHWTHPAHHTGFVVLYALTFFFANFGPNSTTFIVPAEIFPARLRSTCHGISAASGKAGAIIGAFGFLYAAQDQHNPDAGYSRGIGIRNALFVLAGTNFLGMLMTLLVPESKGLSLEEMSKDNVVDETAQEAIAQA*